Dataset for CDS herpesviridae of organism Terrapene carolina triunguis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A674KEW6_vNR13-01 vNR13 gene OS=[Eukaryota] Terrapene carolina triunguis GN=vNR13 (length=537 residues).
atgccgggctcgctgaaggagcagacggcgctgctgctgggcgattacttccagcaccgcctggggggcccggcgctgcc
gccgcccagccccgcggccgagacgctgcggcgggcggccagcgagctggagagccgggagcggcccttcttccgcgcct
gccgcccgctggccctggacgagcgccgggagccggcggcgctgctgagccgggtggcggagcagctggaggcggagggc
ggcctgaactggggccgagtgctggcgctggtggtgttcgcggggagcctggcggcggcgctggccgagcagggcagccg
ggaggaggcgggccgcttggccgaggtgctggcctcctacctggccgaggagaagcgcgagtggctggaggcgcacggcg
gctgggatggcttctgtcatttcttcaatggacatggctctcaaccaactgaccagaacagtaccataagcagtgctatc
atggcagcagcagggtttggactagcaggattagctgttctcttggctgtacgatag
© 1998-2020Legal notice