Dataset for CDS Unclassified of organism Sinocyclocheilus rhinocerous

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A673L8R2_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous (length=531 residues).
atgtcctgttggttgagggaacagactttgttgctggcagaagattacatcagcttctgcagcgggatccaacagactcc
tcccagcgagtcagcagaggccatgagatacctggccaaagagatggagcagcagcacagaaccaaattccgatccctct
cccaggagttcctggacacctgcggatcagatcccagcaagtgtctgcagagcgtcatgagggaactggtgggagatggg
aaactgaactgggggagggtggtctccatctttactttcactggagtgctggctagtgagctcctgtccagaggagagaa
ttccaagtgctcccggagactggccgagaccatcgctgactaccttggaggggaaaaacaggactggctggtggaaaacg
gaggctgggagggtttctgcaggtttttccacaccgcaagacagctgaaccaagagtcttcgatgaagacggcactgttt
gcagcagcaggagtgggtttagctggtctaacctttctcttagtacgctaa
© 1998-2020Legal notice