Dataset for CDS Unclassified of organism Serinus canaria

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C9MNY5_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Serinus canaria (length=318 residues).
atggaggccgacggcggcctcaactggggccggctgctggcgctcgtggtgttcgccggcacgctggcggccgcgctggc
cgagcggggctgcagcgacgggccgcgctgcctggccgctcacctggccgcctacctggccgaggagcgcggcgagtggc
tggaggagcacggcggatgggatggcttctgtcggttcttcggccggccgggctcggagggggccgagcagagcagcacc
atcggcaacgccatggtggcggcggcggcggcggcgggcatcggcgtggcggggctggccttcctcctggtgcggtag
© 1998-2022Legal notice