Dataset for CDS Unclassified of organism Scleropages formosus

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C9T0J9_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Scleropages formosus (length=570 residues).
atgtccagcccattggagagggagaccttgctggtggcaaaggattatgtgggtttctgcactgggatccggcaagaccc
tccaagcgagtcagccaaagccatgagacaactggcgaagcaaacggagaggcaacatcggtcaacatttcaaaccttag
tgcagaacttcttggacaactctgaacccgacttcctgaccagtctgaagcagaccatggcagcgctggcgcatgacgga
cagttgaactggggaagagtcgtagcgctttttgcattcgcaggaatgctagcgagcgagctctcatcccggggagtgga
cgtcagcaacagaaggttagcggagacgatcgctcgctacctcagcgaggagcacggagaatggcttctgcacaacggtg
gctgggtcggcttcctatcctttttccacatggggagaggtgcggacttggggttgttcctgaggaacgctttctttgca
gtctccgttgcgagcattgcagggatagccgcccttcttcgccctggaagacttcctctggggtccttgcttcggctgtt
ttttgcctga
>gnl|bcl2dbcds|A0A8C9TV46_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Scleropages formosus (length=699 residues).
atgtccagcccattggagagggagaccttgctggtggcaaaggattatgtgggtttctgcactgggatccggcaagaccc
tccaagcgagtcagccaaagccatgagacaactggcgaagcaaacggagaggcaacatcggtcaacatttcaaaccttag
tgcagaacttcttggacaactctgaacccgacttcctgaccagtctgaagcagaccatggcagcgctggcgcatgacgga
cagttgaactggggaagagtcgtagcgctttttgcattcgcaggaatgctagcgagcgagctctcatcccggggagtgga
cgtcagcaacagaaggttagcggagacgatcgctcgctacctcagcgaggagcacggagaatggcttctgcacaacggtg
gctgggcaaaaaacagccaaagcaaggatcccagaggaagtcttctagggcgaagaagggcggctatccctgcaatgctc
acaacggagactgcaaagaaagcattctgcaggaacgatcccaagtccacacctctcaccatgcggaaaaaggagaggaa
gccgacctacacaagagacaaacaaaatgccaaggcacagaacaggttggaacacatttacacattatttcagcatttga
tagcatctgcagctctttttccacttcacattggaacatggaaaaccatcctcttcacg
© 1998-2022Legal notice