Dataset for CDS herpesviridae of organism Pelusios castaneus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C8VNX1_vNR13-01 vNR13 gene OS=[Eukaryota] Pelusios castaneus GN=vNR13 (length=534 residues).
atgccgggctcgctgaaggagcagacggcgctgctgctggcagattatttccagcaccgcctggggggcgcagcggccgc
acccagcccggcggccgagacgctgcggcgggcggccagcgagctggagagccgggagcggcccttcttccgcgcctgcc
gcccgctggccctggacgagcgccgggagccggcggcgctgctggcccgggtggctgagcagctggaggcggagggcggc
ctcaactggggccgggtgctggcgctggtggtgttcgcgggcagcctggcggcggcgctggccgagcacgggagccggga
ggaggcgggccgcctggccgaggtgctggccgcctacctggccgaggagaagcgcgagtggctggaggcacacggcggct
gggatggcttctgtcatttcttcaatggacatggctctcaaccaagtgaccagcacagtaccataagcagtgctataatg
gcagcagcaggctttggactagcaggattagcttttctcttggctgtgcgatag
© 1998-2022Legal notice