Dataset for CDS Unclassified of organism Otarine gammaherpesvirus 4

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A889IVX4_uncBALF1-01 Putative BALF1 gene OS=[Viruses] Otarine gammaherpesvirus 4 (length=1266 residues).
atggcttcagcttcagaactggaagcgttaaaggtgtgctgtgctaactctagcttgctgaatcacaacagtgaagataa
tgagagctgcagtgaagatagctgcagcagcgaccatggtgaatactactgttacagcgattatggtagtgaaaccaact
tacattacagaagtcattcaagtgaatgcagatttgatgatgctgacggtatagaacaaggcactactgataacaaccag
aagacaacaatagaaaactgtggaacatataactcagatgcttcaactagcacatataacaacggatacttagaaaagca
agcagcaaataccgtaaatgtgggctcaaaactacagcaggtaaatgtaccaattagtggtggtgaatcattacctgcaa
ataataccagcgcggaacacagactatacgctaactgtcatgaatatatggaactcacatcgcctatgaaatctaagggt
acacagaccccattgcaatatgcaccaaacccacaatctgtggaagaactggcgtcatcggtttctaaaacaacaatgaa
acaaccagcactaatacaagtgccatctgaccagccaccaccaatcccaccaaagctgcacaacaacccatgccataata
gcttccagcggttctacccagtggtgcgctcaacagatgggcgttgcagcgaaccaacttatgcgaatgcgcacattgta
ccagatatgtcatttggcaccaatacggcaaaaacctgcaccattgatctagttagtgctaaatgtatcttcaaggagct
tgcagacaccacccaagtagtatacaacgtgctaaccgcggtgatgttacccaatgaatcaacacaacacctgtcagcat
ctgagcacactctagcatgggtagttacccaatgtatcaaagaagaatggccacgcctaactggcatggtgtttgaccta
ccgccaccagaaaatgccgaccactataaccacgtcatgcgcgtggtggaagttgcacatgcagatgatagtggtagctg
gggccgcctatgtattacacttgctttcatttgcgtatatgctaagtgctatatgaacaactcccgcgaaattagagacc
ggtttgccaacctactatctgattattatgcactcaaccgcatgtcatggctaataaacatgggcggtatcacaaagggt
gtgcgtggacgatttcctttgttttggatgtggtataaactcaaggaagtttttagcagtttttaa
© 1998-2022Legal notice