Dataset for CDS Unclassified of organism Ornithorhynchus anatinus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A6I8NZN5_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Ornithorhynchus anatinus (length=600 residues).
atggcggggtccctgcgggagcagacggcgctgctggtggccgactacctggcgcagtgcgggccgggccccgctccgcc
cgccccgccgcccagccccgccgccgccaccctgcgccgcgccgccgccgccctgcgccgccagcaccgccccttcttcg
tctgcgcccgccggcgggccggggccggggccggaccgggggaccggccgggggacggagacggggccggggacggggac
ggggacggggccggaccggccgcgctgctggcccaggtggcggccgagctggaccacgacggaggcctcaactgggggcg
ggtggtggccctggtggccctggccggggcgctgctggaccccgagccggacccccggacccccgacctcagccggaccc
tggccgacacgctgtgccactacctggccgaggagaagggcgattggctgcgggagcacggcggctgggatggcttctac
catttcttcaaccaaccggagggccgaccggccgaacagaacagcgccttctgcaacgccatcatggccgcggcaggatt
tgggctagcgggattagccttcctcttggccgtgcggtag
© 1998-2020Legal notice