Dataset for CDS Unclassified of organism Malurus cyaneus samueli

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C5T5F9_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Malurus cyaneus samueli (length=498 residues).
catgccgattacttccagcaccgcagcggcggcgccgcgctgcccttcagccccacggcggccgtgctccggcgggcggc
ggccgagctggagcggcaggagcgtcccttcttccgctcctgcgcgccgctggcgcgggccgagccgcgggaggcggccg
cgctgctggggcgggtggcggcgcagctggaggccgacggcggcctcaactggggccggttgctggcgctcgtggtgttc
gccggcacgctggcggccgcgctggccgagcagggttgcagcgacgggccgcgctgcctggccgaacacctggccgccta
cctggccgaggagcgcggagaatggctggaggcgcacggcggatgggatggcttctgtcacttctttggcagacacggct
cggaggcggctgagcagagcagcaccatcggcaacgccatcatggcagctgcggcgggcattggcatggcaggattggct
tttctcttggtgcggtag
© 1998-2022Legal notice