Dataset for CDS herpesviridae of organism Macacine gammaherpesvirus 4

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q8UZJ4_BHRF1-01 BamHI-H right reading frame gene OS=[Viruses] Macacine gammaherpesvirus 4 GN=BHRF1 (length=576 residues).
atggccttttcaacaagagatttactgttagccctgtgtatgcgggacagtcacgttcatggaaacgagggtctgcatcc
tgtgttggagttagcatcaagagaatcaccctccagcctctctgcgggggacactctggttctacgtgtccatgtactgc
ttgagcaaataattgaacaaaatgcgggtgcctttttagaagccttggacagatttttatcaaacaccgaagagtgggat
gtggattttaccagagtgtttcaagaaatcttccaccgtggaaatcccactctgggacgagcgttggcctggctggcctg
gtgcatgcatgcctgcaggacgttgtgttgtaacaggaatactccctactatgttgtggacctgtcggttcgtgggatgt
tagaagccagcgaaggccttgatgcttggattcaccagcaaggcggctggccttctttactgaggggcaaccgttcaaac
accggaagccccatattgactgcatttttagctggactaactttaactttcgtagttgtgtgtagctatctctttatctc
tggaagaagacgctga
© 1998-2020Legal notice