Dataset for CDS vNR13 of organism Laticauda laticaudata

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C5RRS8_vNR13-01 vNR13 gene OS=[Eukaryota] Laticauda laticaudata GN=vNR13 (length=540 residues).
atgccgggcgcgctccgcgaagagacggcgcagctgctgggcgactacgtgcagcaccggctggggggcgcggcgctgcc
tccgccgagccgcgcggccgagacgctgcgccgggtggccgacgagctggagagccgggagcgcctcttcttccgcaacg
cctgcagcgccgccgctttgcccgagcccggcgaggcggcggctttgctgggccgggtggccacgcagatggaagccgaa
ggcggcctgaactggggccgggtggtggcgctggtcgtgttcgccggcaacctggcggcggcgctggccgagcggggcgg
cccggatcacagcggcgcgctggtggaggcgctggccgcctacctggccgaggaacggcgggactggctggaggcgcacg
gcggctgggatggcttctaccacttcttcaataagcacggctcggatgcagctgaccagaacagcactatcagcaatgca
attatggcggcagcaggattcggcctggcaggattggcttttctcttggtggtgcgataa
© 1998-2022Legal notice