Dataset for CDS vNR13 of organism Falco tinnunculus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C4V604_vNR13-01 vNR13 gene OS=[Eukaryota] Falco tinnunculus GN=vNR13 (length=534 residues).
atgccgggctcgctgaaggaggagacggcgctgctgctggaggactacttccagcaccggggcggcggcgccgcgctgcc
ccccagccccacggcggccacgctgcggcgggcggcggccgagctggagcggcgggagcggcccttcttccgctcctgcg
cgccgctggcgcgggccgagccgcgggaggcggcggcgctgctggcgcgggtggcggcgcagctggaggccgacggcggc
ctcagctggggccggctgctggcgctggtggtcttcgccggcacgctggccgccgcgctggccgagcggggctgcggcga
cgggccgcgctgcctggccgccgcgctggccgcctacctggccgaggagcggggcgagtggctggaggcgcacggcggat
gggatggcttctgtcgcttcttcggcagacacggctcccagccggccgaccagagcagcaccataagcaatgcaatcatg
gccgcagcggggttcggaatagcaggattggcttttctcttggtggtgcggtag
© 1998-2023Legal notice