Dataset for CDS Unclassified of organism Cyprinus carpio

[Download (right click)]

8 sequence(s)

>gnl|bcl2dbcds|A0A8C1K0U0_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Cyprinus carpio (length=783 residues).
atgagatctgactgctgtttgcgcaactgtcggtggagagcgcagtctgacatcgctgggaggaaaatgtcctgttggtt
gagggaacagactttgttgctggcagaagattacatcggcttctgcagcgggatccaacagacgcctcccagcgagtcag
cagaggccatgagatacctggccaaagagatggagcagcagtacagaaccaaattccgatccctctcccaggagttcctg
gacacctgcggatcagatcccagcaagtgtctgcagagcgtcatgagggaactggtgggagatgggaaactgaactgggg
gagggtggtctccatctttactttcactggagtgctggccagtgagctcctgtccagaggagagaattctgagtgctccc
ggagactggccgagaccatcgctgactaccttggaggggaaaaacaggactggttggtggaaaacggaggctgggagggt
ttctgcaggtttttccacaatgcaagacagctgaaccaagagtcctcgatgaagacagcactttttgcagcagcaggagt
gggtttagcaggttatttccatgatggtccattgatgttaagagatgagccggtgggaggagatgaaaatcattggagga
acctctctatgactgatgggcactttagacagagagatctgatctgtctgatcctcacaatacagatggtatgtaggcca
accacgctccagcacactctgtttcctacctttgttcctctctttctttctttttctgcttga
>gnl|bcl2dbcds|A0A8C1K0U0_uncvNR13-02 Putative vNR13 gene OS=[Eukaryota] Cyprinus carpio (length=1710 residues).
atgtgcgaccagacgtttttggccatcacgtttggcccatgtgataactgcagtcagaacaaacctctgatgaacattta
tctgaagaatgagcccatcaactactgctccctgtgtgtggagctgatggcctgtcagggactagcgaagggtgaaacca
tccacacactgaaagcggagtctgagactttgaaaaccaaactagaagaggagagagctaaactgcacgacgtcgaattg
catcaagtggcagagaagatagaggctctgggtcaatttgtcatgaagactaggagaaccctgaaaggacatggaaataa
agtgctgtgtgtggactggtgccgggacaagagaagaatcgtcagctcctctcaggatggaaaagtcatagtgtgggatg
catatacaaccaataaggagcatgcggtcactatgccctgcacctgggtcatggcttgtgcttatgccccttctggctgt
gctgtggcttgtggtggtttggataataaatgctccgtctatcctctctctttggataaaaatgagaacttggcagctaa
aaagaaatctgtggccatgcacaccaactatctgtcttcctgcagcttcaccaactctgacatgcagattctgacatcaa
gtggtgatgggacatgtgcattatgggatgttgaaagtgggcagctgctgcagagtttccatggtcactcagctgatgtt
ctttcactgaaccttgcaccctctgaaacaggaaacaccttcgtatcagggggctgtgataaaaaggctaatgtgtggga
catgcgctcgggacagaatgttcagtcctttgaaacacatgagtctgacatcaacagtgtgaagtattaccctagcggag
atgcttttgcaactggatctgatgatgctacgtgtcgcctgtatgacctgcgagctgaccgtgaggttgccatctactcc
aaagagagtatcatatttggagcctctagtgtggacttttccctcagtggtcgattgctgtttgcaggatataatgacta
caccattaacgtctgggatgtcctgaaaggtaccagagtggcaattctctttggccacgaaaatcgggtcagcactgtca
gagtgtcccctgatgggaccgcgttctgctcaggatcatgggacaacactttgcggaaaatgtcctgttggttgagggaa
cagactttgttgctggcagaagattacatcggcttctgcagcgggatccaacagacgcctcccagcgagtcagcagaggc
catgagatacctggccaaagagatggagcagcagtacagaaccaaattccgatccctctcccaggagttcctggacacct
gcggatcagatcccagcaagtgtctgcagagcgtcatgagggaactggtgggagatgggaaactgaactgggggagggtg
gtctccatctttactttcactggagtgctggccagtgagctcctgtccagaggagagaattctgagtgctcccggagact
ggccgagaccatcgctgactaccttggaggggaaaaacaggactggttggtggaaaacggaggctgggagggtttctgca
ggtttttccacaatgcaagacagctgaaccaagagtcctcgatgaagacagcactttttgcagcagcaggagtgggttta
gcaggtctaacctttctcttagtacgctaa
>gnl|bcl2dbcds|A0A8C1K0U0_uncvNR13-03 Putative vNR13 gene OS=[Eukaryota] Cyprinus carpio (length=537 residues).
atgaaaatgtcctgttggttgagggaacagactttgttgctggcagaagattacatcggcttctgcagcgggatccaaca
gacgcctcccagcgagtcagcagaggccatgagatacctggccaaagagatggagcagcagtacagaaccaaattccgat
ccctctcccaggagttcctggacacctgcggatcagatcccagcaagtgtctgcagagcgtcatgagggaactggtggga
gatgggaaactgaactgggggagggtggtctccatctttactttcactggagtgctggccagtgagctcctgtccagagg
agagaattctgagtgctcccggagactggccgagaccatcgctgactaccttggaggggaaaaacaggactggttggtgg
aaaacggaggctgggagggtttctgcaggtttttccacaatgcaagacagctgaaccaagagtcctcgatgaagacagca
ctttttgcagcagcaggagtgggtttagcaggtctaacctttctcttagtacgctaa
>gnl|bcl2dbcds|A0A8C1K0U0_uncvNR13-04 Putative vNR13 gene OS=[Eukaryota] Cyprinus carpio (length=1188 residues).
atgtgcgaccagacgtttttggccatcacgtttggcccatgtgataactgcagtcagaacaaacctctgatgaacattta
tctgaagaatgagcccatcaactactgctccctgtgtgtggagctgatggcctgtcagggactagcgaagggtgaaacca
tccacacactgaaagcggagtctgagactttgaaaaccaaactagaagaggagagagctaaactgcacgacgtcgaattg
catcaagtggcagagaagatagaggctctgggtcaatttgtcatgaagactaggagaaccctgaaaggacatggaaataa
agtgctgtgtgtggactggtgccgggacaagagaagaatcgtcagctcctctcaggatggaaaagtcatagtgtgggatg
catatacaaccaataaggagcatgcggtcactatgccctgcacctgggtcatggcttgtgcttatgccccttctggctgt
gctgtggcttgtggtggtttggataataaatgctccgtctatcctctctctttggataaaaatgagaacttggcagctaa
aaagaaatctgtggccatgcacaccaactatctgtcttcctgcagcttcaccaactctgacatgcagattctgacatcaa
gtggtgatgggacatgtgcattatgggatgttgaaagtgggcagctgctgcagagtttccatggtcactcagctgatgtt
ctttcactgaaccttgcaccctctgaaacaggaaacaccttcgtatcagggggctgtgataaaaaggctaatgtgtggga
catgcgctcgggacagaatgttcagtcctttgaaacacatgagtctgacatcaacagtgtgaagtattaccctagcggag
atgcttttgcaactggatctgatgatgctacgtgtcgcctgtatgacctgcgagctgaccgtgaggttgccatctactcc
aaagagagtatcatatttggagcctctagtgtggacttttccctcagtggtcgattgctgtttgcaggatataatgacta
caccattaacgtctgggatgtcctgaaaggtaccagagtggcaattctctttggccacgaaaatcgggtcagcactgtca
gagtgtcccctgatgggaccgcgttctgctcaggatcatgggacaacactttgcggatctgggcttga
>gnl|bcl2dbcds|A0A8C1K0U0_uncvNR13-05 Putative vNR13 gene OS=[Eukaryota] Cyprinus carpio (length=1116 residues).
tgtattttatcatatttattgacatatctgtcatccatctgtgttttcctaaagatggcctgtcagggactagcgaaggg
tgaaaccatccacacactgaaagcggagtctgagactttgaaaaccaaactagaagaggagagagctaaactgcacgacg
tcgaattgcatcaagtggcagagaagatagaggctctgggtcaatttgtcatgaagactaggagaaccctgaaaggacat
ggaaataaagtgctgtgtgtggactggtgccgggacaagagaagaatcgtcagctcctctcaggatggaaaagtcatagt
gtgggatgcatatacaaccaataaggagcatgcggtcactatgccctgcacctgggtcatggcttgtgcttatgcccctt
ctggctgtgctgtggcttgtggtggtttggataataaatgctccgtctatcctctctctttggataaaaatgagaacttg
gcagctaaaaagaaatctgtggccatgcacaccaactatctgtcttcctgcagcttcaccaactctgacatgcagattct
gacatcaagtggtgatgggacatgtgcattatgggatgttgaaagtgggcagctgctgcagagtttccatggtcactcag
ctgatgttctttcactgaaccttgcaccctctgaaacaggaaacaccttcgtatcagggggctgtgataaaaaggctaat
gtgtgggacatgcgctcgggacagaatgttcagtcctttgaaacacatgagtctgacatcaacagtgtgaagtattaccc
tagcggagatgcttttgcaactggatctgatgatgctacgtgtcgcctgtatgacctgcgagctgaccgtgaggttgcca
tctactccaaagagagtatcatatttggagcctctagtgtggacttttccctcagtggtcgattgctgtttgcaggatat
aatgactacaccattaacgtctgggatgtcctgaaaggtaccagagtggcaattctctttggccacgaaaatcgggtcag
cactgtcagagtgtcccctgatgggaccgcgttctgctcaggatcatgggacaacactttgcggatctgggcttga
>gnl|bcl2dbcds|A0A8C1K0U0_uncvNR13-06 Putative vNR13 gene OS=[Eukaryota] Cyprinus carpio (length=999 residues).
atgttgtttcaaacccataaaaatattttggatgaaaaccgggaggctttgcatcaagtggcagagaagatagaggctct
gggtcaatttgtcatgaagactaggagaaccctgaaaggacatggaaataaagtgctgtgtgtggactggtgccgggaca
agagaagaatcgtcagctcctctcaggatggaaaagtcatagtgtgggatgcatatacaaccaataaggagcatgcggtc
actatgccctgcacctgggtcatggcttgtgcttatgccccttctggctgtgctgtggcttgtggtggtttggataataa
atgctccgtctatcctctctctttggataaaaatgagaacttggcagctaaaaagaaatctgtggccatgcacaccaact
atctgtcttcctgcagcttcaccaactctgacatgcagattctgacatcaagtggtgatgggacatgtgcattatgggat
gttgaaagtgggcagctgctgcagagtttccatggtcactcagctgatgttctttcactgaaccttgcaccctctgaaac
aggaaacaccttcgtatcagggggctgtgataaaaaggctaatgtgtgggacatgcgctcgggacagaatgttcagtcct
ttgaaacacatgagtctgacatcaacagtgtgaagtattaccctagcggagatgcttttgcaactggatctgatgatgct
acgtgtcgcctgtatgacctgcgagctgaccgtgaggttgccatctactccaaagagagtatcatatttggagcctctag
tgtggacttttccctcagtggtcgattgctgtttgcaggatataatgactacaccattaacgtctgggatgtcctgaaag
gtaccagagtggcaattctctttggccacgaaaatcgggtcagcactgtcagagtgtcccctgatgggaccgcgttctgc
tcaggatcatgggacaacactttgcggatctgggcttga
>gnl|bcl2dbcds|A0A8C1MTT1_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Cyprinus carpio (length=597 residues).
atgaggtttgactgctgtttgcgcaactgtcggtggagagcgcagtctgacatcgctgggaggaaaatgtcctgttggtt
gagggaacagactttgttgctggcagaagattacatcagcttctgcagtgggatccaacagacgcctcccagcgagtcag
cagaggccatgagatacctggccaaagagatggagcagcagtacagaaccaaattcagatccctcacccaggagttcctg
gacacctgcggatcagatccctgcaagtgtctgcagagcgtcatgagggaaatggtgggagatgggaaactgaactgggg
gagggtggtctccatctttactttcactggagtgctggccagtgagctactgtccagggaagagaattccgactgctccc
ggagattggccgagaccattgctgactaccttggaggggaaaaacaggattggctggtggaaaacggaggctgggagggt
ttctgcaggtttttccacaaagcaaaacagctgaaccaagagtcctcgatgaagacagcactgtttgcagcagcaggagt
gggtttagcaggtctaacctttctcttagtacgttga
>gnl|bcl2dbcds|A0A8C1MTT1_uncvNR13-02 Putative vNR13 gene OS=[Eukaryota] Cyprinus carpio (length=672 residues).
atgaggtttgactgctgtttgcgcaactgtcggtggagagcgcagtctgacatcgctgggaggaaaatgtcctgttggtt
gagggaacagactttgttgctggcagaagattacatcagcttctgcagtgggatccaacagacgcctcccagcgagtcag
cagaggccatgagatacctggccaaagagatggagcagcagtacagaaccaaattcagatccctcacccaggagttcctg
gacacctgcggatcagatccctgcaagtgtctgcagagcgtcatgagggaaatggtgggagatgggaaactgaactgggg
gagggtggtctccatctttactttcactggagtgctggccagtgagctactgtccagggaagagaattccgactgctccc
ggagattggccgagaccattgctgactaccttggaggggaaaaacaggattggctggtggaaaacggaggctgggagggt
ttctgcaggtttttccacaaagcaaaacagctgaaccaagagtcctcgatgaagacagcactgtttgcagcagcaggagt
gggtttagcaggtctaacctttctcttacaaacagtcattcatgttgattgtacactcttcacatggccttcaggagaaa
agaatggaatttctaattctttgcatatctaa
© 1998-2023Legal notice