Dataset for CDS Unclassified of organism Cyanoderma ruficeps

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C3QI35_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Cyanoderma ruficeps (length=540 residues).
atgccgcgctcgctgaaggaggagacggcgctgctgctggaggattacttccagcaccgcggcggcggcgccgcgctgcc
tcccagccccacggcggccgcgctgcggcgggcggcggccgagctggagcggcaggagcggcccttcttccactcctgcg
cgccgctggcgcgagccgagccgcgggaggcggccgcgctgctgggaaaggtggcggcgcagctggaggccgacggcggc
ctcaactggggccggctgctggcgctcgtggtgttcgccggcacgctggcggccgcgctggctgagcggggctgcggcga
cgggccgcgctgcctggccgcccacctggctacctacctggctgaggagcgtggcgagtggctggaggcgcacggcggat
gggatggtttctgtcggttcttcggcagacacggctcagaggcggcggagcagagcagcaccatcggcaacgccatcgtg
gcggctgcggcgggcattggcattggcatggcgggattggctttcctcttggtgcggtag
© 1998-2022Legal notice