Dataset for CDS Unclassified of organism Chelonoidis abingdonii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C0GYM6_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Chelonoidis abingdonii (length=306 residues).
gcggagggcggcctgaactggggccgggtgctggcgctggtggtgttcgcggggagcctggcggcggcgctggccgagca
gggcagccgagaggaggcgggccgcttggccgaggtgctggcctcctacctggccgaggagaagcgcgagtggctggagg
cgcagggcggctgggatggcttctgtcacttcttcaatggacatggctcgcaaccaactgaccagagcagtaccataagc
agtgctatcatggcagcagcagggtttggactagcagggttagctgttctcttggctgtacgatag
© 1998-2022Legal notice