Dataset for CDS Unclassified of organism Catharus ustulatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C3V615_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Catharus ustulatus (length=522 residues).
atgccgcgctcgctgaaggaggagacggcgctgctgctggaggattacttccagcaccgcggcggcggcgccgcgctgcc
ccccagccccacggcggccgcgctgcggcgggcggcggccgagctggagcggcaggagcggcccttcttccgctcctgcg
cgccgctggcgcgggccgagccgcgggaggcggccgcgctgctcggaagggtggcggcgcagctggaggccgacggcggc
ctcaactggggccggctgctggcgctcgtggtgttcgccggcacgctggcggccgcactggccgagcggggctgcggcga
cgggccgcgctgcctggccgcccacctggccgcatacctggccgaggagcgcggcgactggctggaggcgcacggcggat
gggtgagcggggatgggcggcctggggcggctctgagcaaaacatcagctatcccacagatctgctcatttcctattccc
agtcctagtggaatactttatgtcagtacaaataagcactaa
© 1998-2023Legal notice