Dataset for CDS Unclassified of organism Anas zonorhyncha

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8B9VPR7_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Anas zonorhyncha (length=456 residues).
atgccgggctcgctgaaggaggagacggcgctgctgctgcaggattacttccagcaccgcggcggcggcaccgcgctgcc
gcccagcgccacggcggccacgctgcggcgggcggcggccgagctggagcggcgcgagcggcccttcttccgctcctgcg
cgccgctcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngctgggcgccgtg
tggggccgggggagcctggcgaggtacctgctggaaggagcgtgcttcaggcgtcccagcggctccgcctgcgcttgcaa
gcaagatggcttctgtcgcttcttcggcaggcatggctctcaaccagctgaccagaacagtaccataagcaatgctataa
tggcagcagcagggtttggaatagcaggattagctttcctcttggtggtgcgatag
© 1998-2022Legal notice