Dataset for CDS Unclassified of organism Anas platyrhynchos

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8B9SL62_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Anas platyrhynchos (length=534 residues).
atgccgggctcgctgaaggaggagacggcgctgctgctgcaggattacttccagcaccgcggcggcggcaccgcgctgcc
gcccagcgccacggcggccacgctgcggcgggcggcggccgagctggagcggcgcgagcggcccttcttccgctcctgcg
cgccgctcgcccgggccgagccgcgggaggcggcggcgctgctgcggcgggtggcggcgcagctggaggccgacggcggc
ctcaactggggccggctgctggcgctcgtggtgttcgccggcacgctggcggccgcgctggccgagcggggctgcgggga
cggcccgcaccgcctggccgaggcgctggccgcctacctggccgaggagcgcggcgagtggctgcgggagcacggcggat
gggatggcttctgtcgcttcttcggcaggcatggctctcaaccagctgaccagaacagtaccataagcaatgctataatg
gcagcagcagggtttggaatagcaggattagctttcctcttggtggtgcgatag
© 1998-2023Legal notice