Dataset for CDS Unclassified of organism Accipiter nisus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8B9M4X0_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Accipiter nisus (length=1140 residues).
atgccactgcatttgtttggtaaatacgcgacgggctcgcccttcggccctcgaaaacctgcagctcctttgatgcaaag
aatacaggttcgggccaccaagggggggaaacctcccccgtctgaagaaacggcacgccgcgactcagcgtttcgctcga
ccgccccgggaaacgcgcggctttgtgcagccggtgccctccccgggggtgcgggcggaccctgcggggacggggcgccc
gctccccggcagcaccccgccggccggccggccggccgaggccaggccaggcgaggcggagggaggcgaggcgaggcggg
ccgtgccggcccggggccgcctccccgccccgggtttggctttccgccgcgccgggccccgccccggagaaggggagcgc
tcccccagcgccccggggcgggctgggctgggccgggccgggccgggccgggcggaggggccgccccgcctcgcctcgcc
tcgcctcgcctcttagtcggcggcagctgctgctgcggggccgcagccatgccgagctcgctgaaggaggagacggcgct
gctgctggaggactacttccagcaccgcggcggcggcgccgcgctgccccccagccccacggcggccacgctgcggcggg
cggcggccgagctggagcggcgggagcggcccttcttccgctcctgcgcgccgctggcgcgggccgagccgcgggaggcg
gcggcgctgctggagcgggtggcggcgcagctggaggccgagggcggcctcaactggggccggctgctggcgctggtggt
cttcgccggcacgctggccgccgcgctgaccgagcggggctgcggcgacgggccgcgctgcctggccgccgcgctggccg
cctacctggccgaggagcggggcgagtggctggaggcgcacggcggatgggatggcttctgtcgcttcttcggcagacat
ggctcccagccggctgaccagagcagtaccataagcaatgcgatcatggctgcggcggggtttggaatagcaggattggc
ttttctcttggtggtgcggggccagaagcgcttgtactacagacgactattgatttccaaaaagaaagcgactgatgaat
tgctgcaggtccagctctag
© 1998-2022Legal notice