Dataset for CDS adenoviridae of organism unidentified adenovirus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8G1GLF6_E1B19K-01 E1B19K gene OS=[Viruses] unidentified adenovirus GN=E1B19K (length=498 residues).
atggagttttggagtgagctacaaagttatcagagcctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggaggtttatttttggttcaaccttaactaatgtaatttatagagctaaagaggactactcttcgcgatttgctgagc
ttttgtcttttaaccctggaatttttgcatctttaaatttgggccaccactcatttttccaggaaattgtgatcaaaaac
ttagatttttcttcccccggccgtacggtttctgggcttgctttcatttgttttatattggatcaatggagcgcccaaac
ccatctgtcggaggggtatactctggattacatgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
gttgctcgccggcgcagcctccgcacggtctggatccagtgcrggaggaggaggaggagaacctgagggccggtctggat
cctcaaacggaattgtaa
© 1998-2022Legal notice