Dataset for CDS Unclassified of organism Skunk adenovirus HUN 2009

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A7D3UMS6_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Skunk adenovirus HUN/2009 (length=549 residues).
atggatatcttacaattgtgttcctcctatagccagtttaggggcattattcgcgggaccacctatagggccgggtgggt
tagaagatggtgttttcaccccctcacagatattgttgcaaacctagctgaggattttgatactagatattggctagcct
tgcctctgggtcacccctattgggagttgcttaagaggggctataccttcgcaggcaacccagacctctttgggggagtg
gacctgtccactcggggaagggccttagcatttttgggctttttaacctttattctgcgtaattggcctcctgattctgt
agtgccctccgaagcaagaattgacctggtctgtgtcccagcatggaccaaaatccaaatgtggacgcagaccctgaagc
tgctcgaggaaatgcaaaccgcgcgggccatgccagaagaagaagaagaggggctcacgtcgccctcggacgaggaggtc
gcttcagactcaacagaccagccggacccccacagcgacgaggaccctttccccccggagacggagtga
© 1998-2021Legal notice