Dataset for CDS adenoviridae of organism Human mastadenovirus F

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A6B9DS29_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus F GN=E1B19K (length=504 residues).
atggagttttggagtgagctacaaagttatcagagcctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggaggtttatttttggttcaaccttaactaatgtaatttatagagccaaagaggactactcttcgcgatttgctgagc
ttttgtcttttaaccctggaatttttgcatctttaaatttgggccaccactcatttttccaggaaattgtgatcaaaaac
ttagatttttcttcccccggccgtacggtttctgggcttgctttcatttgttttatattggatcaatggagcgcccaaac
ccatctgtcggaggggtatactctggattacatgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggaggaggaggaggagaacctgagggccggt
ctggatcctcaaacggaattgtaa
>gnl|bcl2dbcds|A0A6M6AES6_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus F GN=E1B19K (length=498 residues).
atggagttttggagtgagctacaaagttatcagagcctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggaggtttatttttggttcaaccttaactaatgtaatttatagagctaaagaggactactcttcgcgatttgctgagc
ttttgtcttttaaccctggaatttttgcatctttaaatttgggccaccactcatttttccaggaaattgtgatcaaaaac
ttagatttttcttcccccggccgtacggtttctgggcttgctttcatttgttttatattggatcaatggagcgcccaaac
ccatctgtcggaggggtatactctggattacatgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggaggaggaggagaacctgagggccggtctggat
cctcaaacggaattgtaa
>gnl|bcl2dbcds|A0A6M6AEV2_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus F GN=E1B19K (length=504 residues).
atggagttgtggagtgagttacaaagttatcagaacctccgacgcttgctggagttggcttctgccagaacttccagctg
ttggagaatcctttttggctcaactttaactaatgtaatctatagagctaaggaggagtactcttcgcggtttgctgacc
ttttgtcgcataaccctggaatttttgcttctttgaatttggggcatcactcattttttcaagaaattgtaatcagaaat
ttagatttttcttctcctggccgtacggtttctgggcttgcttttatttgttttatattggatcaatggagcgcccaaac
tcatctgtcgcagggttatactctggattacatggcaatggctctgtggagaaccttgctacggaggaagagggtcttag
gttgcttgccggcgcagcgtccgcacggtttggatccagtgcaggaagaggaggaggaggaggagaacctgagggccggc
ctggacccttcaacggaattgtaa
© 1998-2021Legal notice