Dataset for CDS adenoviridae of organism Human mastadenovirus A

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|T1UEX7_E1B19K-01 E1B19K gene OS=[Viruses] Human mastadenovirus A GN=E1B19K (length=471 residues).
atggagctagaagctgtgttgcaaagttttcagagcgttcgtcagcttctgcagtatacctctaaaaacacttcaggttt
ttggagatatctgtttggttctactttaagcaaggtggtacatagggtgaaggaagattacagagaggaatttgaaaaca
tattggccgactgtccagggcttttagcttcattagatctttgccaccactctgtttttcaggaaagagtggtcagatct
ttagatttttcatcttctggccgaacggttgcttctattgcctttttggcaaccgtgttggataaatggagcgagaggtc
ccacctgagctgggattacatgctggattacatggcaatgcatttgtggagggcatggctgaagaggagggtttgcattt
actcgctggcgcggcctctaaccatgccgccgttgcaggaggagcagcagaacactacgacggaggagtaa
>gnl|bcl2dbcds|T1UEX7_E1B19K-02 E1B19K gene OS=[Viruses] Human mastadenovirus A GN=E1B19K (length=1419 residues).
atggagcgagaggtcccacctgagctgggattacatgctggattacatggcaatgcatttgtggagggcatggctgaaga
ggagggtttgcatttactcgctggcgcggcctctaaccatgccgccgttgcaggaggagcagcagaacactacgacggag
gagtaaacatggaaccacaggtgcaagaaggccatgaacctgaccccgacgaagggcctagttgtgcagttgttaaaaag
cgggaaagaaaagaaagtttaaaggaaactgtccttaataggctgactgttaacctaatgtctcgcccgcgcttggaaac
tgtatattggcaggaattacaggatgaatttaagcagggacacatgcatctacaatacaagtacagttttgagcagctaa
aaacccactggctagaaccatgggaggatttagagtgtgctattaaagcttttgctaaagtagctttacgccctgactgt
acttataaaatctctaagacagtaactattacgtcatgtacgtacattataggcaatggggcagtagttgaggtggacac
tagtgatagagttgcttttaggtgtcgtatgcagggcatgggtccgggggtggtaggtttggatggcattacatttatga
atgttaggtttgctggagaaaaatttaagggcattatgtttgaggctaacacaagtgttgtattgcatggtgtgtacttt
cttaactttaataacacgtgtgtagagtgttggaataaggtttctgccaggggttgcactttttatgggtgttggaaggc
cttggtaggtaggcccaaaagtaaaatgtctgtaaaaaagtgcttgtttgagaaatgcgtgcttgctttaattgtagaag
gggatgctcacattagacataatgcagcttcagaaaatacctgttttattctactgaagggaatggctattttaaagcac
aatatggtttgcggggtgtctgatcagacaatgcgacggtttgtcacctgtgctgatggaaattgtcacactttgaaaac
tgttcatattgtgagtcatgctagatattgttggcctgtgtgtgaccataacatgtttatgcgctgcacaatacatttgg
gtctccggcggggtgtgtttagaccttcccagtgtaactttagtcattcaaatgttatgttggagcccgaggcgttttcc
agagtgagtttaaatggggtgtttgatttatctgtggaattatgcaagattatcaggtatgacgatgctgcccgtcatcg
ctgccggcagtgcgaatgtggcagtagtcatctagaacttcgccccgtcatgctgaatgtaactgaggagctaagaagtg
accatcttaccctgtcttgtctgcgaaccgactatgagtctagcgatgaagacaactaa
© 1998-2022Legal notice