Dataset for CDS Unclassified of organism all

[Download (right click)]

42 sequence(s)

>gnl|bcl2dbcds|A0A3Q1G016_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Acanthochromis polyacanthus (length=522 residues).
atggatgatgaggaggaggacatgtcacggcccatctcgcagctctggggaacgtcctttggggacgtcaaattcgaaga
ccgcgccacacagatcacagccggacaggccttcgccagccacgacaacaacagcatcaacgcgctgccctgcggcttac
accggcagcctcacataccctttcacggcaacgctggattgcgctcacattttcccgctcagtttgagcccatggaggac
cggggagagagggaggttgaagaggaggaggaagagggcagaggggaagacaatgaaagaatggcggagcggcccgagga
gcaggcgggggtgagcgtggaggcgcagatcggtcgtaaacttcgggagatcggagacaagtttcaccaggatcatgttg
aactgtttatgaggcatcagagacaaaacctgcctgtctggatgcgccttacgatggccctgtttggctttttgtttcca
agagaggcccacgtcccccgtctgagaggagcgcagagatga
>gnl|bcl2dbcds|A0A3Q0RUR2_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Amphilophus citrinellus (length=537 residues).
ttggcgagaccaccaaaaccgtccgatggcccgaccgcagtaacggcatcagaggacagcgggggagatccaccacccgt
gtgtgccactggagcgcaaacatcccgtttaaaccgcgagtctactggaggaggagaaccggattcgccttcctgggcca
gaaccccgacgagctttgcggcttatcagagcagaacaatatttcgcttccctcgccgttcctccagtggatatttttcc
atggagtgcgactcgatgccgagctccccgctctccccgaagccaatgatggctgacaaagcgatacagaccccaagcct
ctcaagccaggtgctaacgcacgccctgcagcgcatgggtgaagtacgcgacgaaggaccggagacgaaccaacaacagg
gtgagcacagacaaatgtgtgtatttgtgtactatgacacacaatgtaggaacctgtcagtgaacctaaagaaagaaagt
tctgcctcgcctaatggttttcaagtttatattcttggcagtatttttattagttaa
>gnl|bcl2dbcds|A0A3Q0SC56_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Amphilophus citrinellus (length=423 residues).
atggacgatgaggaggatgatgtgtttaagccnaaagcccgctgctggcacaccacattcaggcagataaagtgtgaaca
ccgaggcacacagacacccggtcctgccctggtaccaaacaacggcatgctgccctgttttcgattgcacttcccagcac
gctttgagcttgttggggatcacgaagcgcggcaacaagaaagcgaagagcagccaaacaggatggagcgtctgccccgg
cagcgacccgtggcacgcggcgtggaggcttgcattggacagaagctccagctcataggagaccagtttcaccgggaacg
cctacaactggggccgctgtggtggcgcctggccgcggctctcctcagccttctgtttgatagggggttctttgctggag
gaggtggcgcaggacggaggtga
>gnl|bcl2dbcds|A0A3P8RSQ3_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Amphiprion percula (length=516 residues).
atggatgatgaggaggaggacatgtcacggcccatctcgcagccccggggaacgtcctttggggacgtcaaattcgaaga
ccgcgccacacagatcgcagctggacaggccctcgctgccgtcactgccgctgtgtccacgtcgcagagccacaacaaca
acagcatcaacgcgctgccctgcggcttacatcggcagcctcacataccctttcacggcaacgctgggttgcgctcacat
tttcctgctcagtttgagcccatggaggaccggggagagagggaggttgaagaggaggaggaagagggcagaggggaaga
caatgacagaatggcggagaggcccgaggagcaggcgggggtgagcgtggaggcgcagattggtcgtaaacttcgggaga
ttggagacaagtttcaccaggatcacgttgaactggtaagcctcactgctgagctgtggaccagatccacgattaactgt
ccacttcaaacaccacactctagagctcaatcttaa
>gnl|bcl2dbcds|A0A3Q1HMF6_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Anabas testudineus (length=429 residues).
atggatgatgaggaggaggacatgtcacggcccatctcgcagcactggggaacgccctttagggacgtcaaatacgaaga
cctacccacacagatctcagccggacaggcccttgctggcatcaccgcgcggcagcctcacataccctttcacggtaaga
aggggttacacgttgagccggccagacacagggaggatgatgacaggatggcacagaggcccgaggatcaggcaggggtg
agcgtcgaggtgcaaattggccgtaaacttcgagagatcggagacaagtttcaacaggatcaccttgaactgtttgtaag
gcaccagagacaaaatctgccaatctggatgcgccttactatggccctgtttggctttctatttccaagagaggctctca
tcccccgcctgagaggagagcagagataa
>gnl|bcl2dbcds|B6IM60_uncEGL1-01 Putative Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis briggsae (length=405 residues).
atggattctcgcttccaattctcttcttcatcatcatgtttcaatcgtcccacaaaactgtccaaaaacgtcaaatttga
gttttcgagtcaggaaatcgcattggatcgtttcaacaccacccgaatggaacctttcttctccattggccacactattg
gaaagcaacttagtaaattatgcgacgactttgacaaggagatgatggcgcatgctcacaaaacgtcgatcgttgcaact
gtgaaatcgctatggaacgtcatgttcaccaacttctctccccaagaagctttttgttttgacgtaaaaaacaagaacag
ccgcactcgtcgccattgctccgttattgccaagcgttgccgagttctcttctccaaagttttcaatttcatcatcaagt
gttaa
>gnl|bcl2dbcds|Q9TY06_uncEGL1-01 Putative Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis elegans (length=297 residues).
atgatgtcgtacaagcgtgatggatatttttcaattgtgtcaagctgcctaattttttgtctacactttctcccgctgtt
gtctattaggaccaaattaagctccctgtttatcacttctctcgcaaataatgcttgcaactcaaacaccgttgaatata
atattggcagaaaactgacagttatgtgcgacgagtttgactctgaactgatgtcctacaaagaagaaaaatcatttgtg
aaatttctaggctcaggattcaagacgtatgccagcattgttcgtcgtgttttttaa
>gnl|bcl2dbcds|A0A3G3M2I9_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Carassius auratus (length=267 residues).
atgtctgacacgtccgaggtatggtttgccgaacctagccaccagcacgtgcagatggcagcacctgtgggagccatggg
gccggagatttcggtcgctcgggagctgcggcgcattggagacgagttcaaccgcttgtactgtcaaggggccggtgcag
gtgggaacaacagagcccagctgcatgctcccaatgaacacgccatcatcatgtggatgaacgaccttatcggacgtgta
gtacagtttttcctgcgaagaagatga
>gnl|bcl2dbcds|A0A6F9BUT0_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Coregonus sp. 'balchen' (length=585 residues).
atgaatatctttgacaggttgactgggagacgacctctgaggctcctaatggatgatgaagaggaggacatgtctcttca
gcgtcgtcctgtctcccagtgctggggcacccccttcagggacatcaagttccacgacagagacggcagggacagaggag
acacccaggacaggtctacacagacgtcgactggacccaacgccattgtcccacggtcagagggacacaacatcatggca
ccacaaggccacaacaacaacaacacccttccctgtgggcttggttcaagcccctggacgaccggggagagaggcagaac
ggggagggaagaagggaggaggaggaggaggaggaggagggggaggaggaggagaatggaggagagaccagaggaagagc
gggcggaggatagcgcggaggcgaggatcggacgtaagctccgggagatcggagaccagttccaccaggaccatgttcaa
ctggtaagggtcaaagtctggatgcgtctgaccatggccctctacggcttcctgtttaacagagaggcccccgccgtacc
ccacctgagaggacaggagagatga
>gnl|bcl2dbcds|A0A3P8UBL4_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Cynoglossus semilaevis (length=351 residues).
atgagaagaaaaggcgagttcatttcagctcgtgcaccgacgggccgttcagtcgagtgtcagagagaaggagggagggc
ggaggagaggaaatctcctcagagcacagacaaaagagttaggagtttgtttaccgactccgtgccgagctccccgaggc
cagtgacggctgacaaagccacgcagactccgagtccctccgcccaggtgatcaatcacgccctgctgagcgtggccgag
acgcagcggacgaacggtgaacgactacgacagattcatccggaacgtgagtggcctctgacgtgtgtgtgtgtgtgtgg
gtttgtgtttttgtacctgtgtgggcgataa
>gnl|bcl2dbcds|A0A3P8W5W5_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Cynoglossus semilaevis (length=264 residues).
atgaaacaggaattcagaataaagccagagtatacagaaaacatgatgaataaattattatttacaccctcactgttaag
ctgccctggcagtcgtatttgcttgtttcctctgaggcattgttgtgggggatgcaacactgaaagccagttggaaatgg
tttgtcctccatttcaactttcagcattttccactgcctgtccagtcgtgcttcctttgactcctctgactcaatcaaga
cgtgaggattctcgttggtattga
>gnl|bcl2dbcds|A0A3Q2FS95_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Cyprinodon variegatus (length=729 residues).
atgaatgacatgcaatcttcaagaccgccaaacctgcgcgatggctcgaccgaagtaacttcagaggaggggaccgaggg
agacccagcagcctcagcgcgaaaaccacgtctgtcgaagcgcagagagcggagctgcgcgctgcagccgggcgccgctg
gcaccgcaggaggaggaagggatccggactcggactcgccgccctgttccgtaagcccggccagtttagacgtctttcga
agcaggtcgattttccgccctactcgccgctcatccagcggatacttctcctttgactgtgactcgcttccgagctcccc
gctcaccccgcacccggtgacggctgacaaagccacacagactgccagtcccacgggccaggtgatgaagcacgccctgc
agcgaatggctgtggagcagggtggacagggagcgcccgggctgcacggacattctgccataccctatagcgagtgggag
ggaatcgcagcacgggatatgcagtcagaaacctttggtcgtcagctccggaccatcggagatgaatataacaaccacct
gctgagaatggcaggaagacaccgacggaatattgtccctctaaacctgatgccacacatccaacaagagccagttgcca
tgctctgtgtcggactcctgcttctcttgattggacgaataatgtacttgcaaggcagtacaagcagccatgaccaccct
caggtttag
>gnl|bcl2dbcds|A0A2R8RYV1_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Danio rerio (length=681 residues).
atggatgatgaggaggatgaacagcttcctcgctgctgtgaaacgccgctaagaaacaagcgctccgagaagagagacgc
ccacggtggagacgtgggacaaacagctcacagacacgcatccacacagactgctggctctgtcctcaattcagcgagag
acgcagatatggcaccattccagggctcacagagagaagcatcatctctttgcagagttgtgggtgctaggactgcattc
agggctccctgtggaactgggggccttgtgtcacttactatgggccccggagcccggggtgggccaagagcactttttca
tggaaacgctggatttcgtgcacacttccctgcgctgttcgaacccgccctggatggcttacaaaacgccgaacagagag
agcaggacgaaggcagaccagaagaaaaagaagaggatcgcgacgcagggattagcgtggaggtccagattggacgtaaa
ttacgtgaaatgggggatcagtttcagcaagagcatcttcagctggtaagagtcattcacatcagactgattcttttctt
caaggccgctgggtttcagatgtgtgtggtcagaaactggtggtttcagtcacgatgcaaaatgacatcactgtctgcta
tttcagtgctgaatatgcaaattcccaagagggagcaatga
>gnl|bcl2dbcds|Q0GKC4_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Danio rerio (length=627 residues).
atggatgatgaggaggatgaacagcttcctcgctgctgtgaaacgccgctaagaaacaagcgctcagagaagagagacgc
ccacggtggagacgtgggacaaacagctcacagacacgcatccacacagactgctggctctgtcctcaattcagcgagag
acgcagatatggcaccattccagggctcacagagagaagcatcatctctttgcagagttgtgggtgctaggactgcattc
agggctccctgtggaactgggggccttgtgtcacttactatgggccccggagcccggggtgggccaagagcactttttca
tggaaacgctggatttcgtgcacacttccctgcgctgttcgaacccgccctggatggcttacaaaacgccgaacagagag
agcaggacgaaggcagaccagaagaaaaagaagaggatcgcgacgcagggattagcgtggaggttcagattggacgtaaa
ttacgtgaaatgggggatcagtttcagcaagagcatcttcagctgtttactcaaaggggccaaatgggtttgttccagct
catgacgtcgatctacaacttcctttttccccaagagagaccccaaaatgcaagagcccacagatga
>gnl|bcl2dbcds|Q0GKC4_uncBMF-02 Putative Bcl2 modifying factor gene OS=[Eukaryota] Danio rerio (length=681 residues).
atggatgatgaggaggatgaacagcttcctcgctgctgtgaaacgccgctaagaaacaagcgctcagagaagagagacgc
ccacggtggagacgtgggacaaacagctcacagacacgcatccacacagactgctggctctgtcctcaattcagcgagag
acgcagatatggcaccattccagggctcacagagagaagcatcatctctttgcagagttgtgggtgctaggactgcattc
agggctccctgtggaactgggggccttgtgtcacttactatgggccccggagcccggggtgggccaagagcactttttca
tggaaacgctggatttcgtgcacacttccctgcgctgttcgaacccgccctggatggcttacaaaacgccgaacagagag
agcaggacgaaggcagaccagaagaaaaagaagaggatcgcgacgcagggattagcgtggaggttcagattggacgtaaa
ttacgtgaaatgggggatcagtttcagcaagagcatcttcagctggtaagagtcattcacatcagactgattcttttctt
caaggccgctgggtttcagatgtgtgtggtcagaaactggtggtttcagtcacgatgcaaaatgacatcactgtctgcta
tttcagtgttgaatatgcaaattcccaagagggagcgatga
>gnl|bcl2dbcds|A0A452H537_uncHRK-01 Putative Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Gopherus agassizii (length=264 residues).
atgtgcccctgcgcgctgcacggcgggccccccgccgcttgcccctgcagctccgcccggcgcggggcgcgcttctccgg
ggctcagctggtggcggcccgcctgaagctggtcggggatgagctgcaggagcggaccgcgtggcgcagggcgagcagca
ggcgagctgcggccgggagaagcctggccacctacctgtgtctgctgtgcgccgcctcgcaggtggccgcgctggtctgg
ctgatccgcaagaggagctggtag
>gnl|bcl2dbcds|A0A3Q4AXL5_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Mola mola (length=438 residues).
atgccgtataaaaacaaaatagatacaagatctccatgtgactgcttccacgctgtgtttcccccaccgtcctgtgccgc
tggagccccagcgcaaataagccgttccgacaacggtggcgagcggcgctccagcggattcggagaaccggactcgccgt
cctggcgcgggatcattcccgtcgacagtctaggcgtgtttcagacgatatttcacctcccacgaagcctctccatcgga
tatttctccgccgacggtgactcgctgcctacctcgccgctctccccgaggccaccgacggctgacagagcgacacagac
tccgagcctcagcggccaggcgatgcaacacgccctgcagcgcatggccgggctgtgcggcggagaaccggggaccacgg
ggttaatccgacaaatgtgggatatacaaccgatgtag
>gnl|bcl2dbcds|G1PFC4_uncBIK-01 Putative BCL2-interacting killer gene OS=[Eukaryota] Myotis lucifugus (length=240 residues).
atgtctcaagcaggacacctctccaggagcctcatcttgtgcaccttcctgcaggagcacgggctgcaagcggtggagga
tcccggcgtgaccagcctcctccagtactcgcctgagcccctgggccctcgcagagccctccctcacgaggtggccatgc
ggctggccttcattggggacgagttggaagtgagatggacgctgccccgctttgcccacgtgccctggatggccatgtac
>gnl|bcl2dbcds|A0A668RHT7_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Oreochromis aureus (length=696 residues).
ttggcaaaaaaaggaataaaaagttcgcgcgtgtgtaaaattcagttaagtgacataagtcccgcagttctgatgggata
tttggaaacaaagtcacgtcctgccagcggatcgctggaatacgtgcggctgaaactccagacgaaacaacagcgagagg
ctgttggctcgcaaacatcccgtttaaaccgcggctctaccggaggaggagaaccggattcgccttcctggtgcagaacc
ccgaagagctttgacgtttttcagagccggacgatattccgcttccctcgccgttcctccagtggatatttttcctctga
ctgcgactcgttgccgagctctccgctctccccgaagccagtgatgtctgacaaagcgatacagaccccgagccccaccg
gacaggtgctaatacacgccctgcagcgcatgggtgaggtgcgcggtgaaggaccgggcacgcaacacggtgagcacaga
ctcttcatgtataacagccgcattaatgtgagtgcacgcactgttactaatgatagtgaaaagatgaacaaaaacatact
taggatgttttgctatctagtttcatacttaagatgtgtttgttttcacccctttctcactgtagagcttagtcatgaaa
gagagccgtttttccactactctgatgtgctgtgcttgctattctcacatgagtaa
>gnl|bcl2dbcds|A0A6I8PDD6_uncHRK-01 Putative Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Ornithorhynchus anatinus (length=345 residues).
atgtgcacggtgccccggggcggcgggggttgcggcgggggttgcggcggggagggcggggtgggcgggggttgcgggtg
ggggtcggggtctgcggcgcgggtgacggtggcgcgtctgaaggcgctgggggacgagctgcacgagaggacggcggcgc
ggaggaggcggctgggccgcgggggacggggccggggggtcctgccctccctgccttcgtccctgccctccctgccctcc
ctgccttcatccctgccatcctcgcccccgggctgggcttggctgtgcgcggcggcgcaggtggcggtcctggcggcctg
gctgctccggaggagaaacctctaa
>gnl|bcl2dbcds|A0A3P9JZK2_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Oryzias latipes (length=453 residues).
atggatgatgaggaggacgacatgtcacggcccgtctcacagctctggggaactccctttagggacgtcaaattccagga
gcgagccatacggatcagcgccggggaggacgtcacagccatgcctgcgtcgcaggagaacagcaccgacgtgccgtcct
gccgcttccgctggcagccgcgcatgccttttcatggtgaggctcctgcatcccgggaggacagagggcaagacgatgag
gtggcagaaaggcctgaggagcggccggaggtgagcgtggaggtccaaatcgggcgaaaacttcgggagattggagacaa
gttcaaccaggatcacttcatgaggcaccagcgacagaacttccccgtgtggatgcgcctcaccgccgccctgttgggct
ttttgtttccaagggaggctctcgtccctcgcctgagaggagagctgagataa
>gnl|bcl2dbcds|W5P3K2_uncHRK-01 Putative Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Ovis aries (length=129 residues).
atgtggcggcggcgcgcgcggggcgggggggcgccggcgcccggcgcgctccctacctactggccctggctgtgcgcggc
cgcgcaggtggcggcgctggcggcctggctgctcggcaggcggaacttg
>gnl|bcl2dbcds|A0A3B4DQ45_uncBBC3-01 Putative BCL2 binding component 3 gene OS=[Eukaryota] Pygocentrus nattereri (length=561 residues).
atggctcggccgcagatggacagcagggtggacagtcagagtcccacggcaccgcagagctgcaggatggaggtgctgcg
tcgggacgcctggcccagtggaggcacacattcagcctctcaggcccgccaccggcatcggaccatggccactcagacca
gccctgtactcctgtcccatgcccgcacacaagatgctgcaagcttgcccaacaccaaccagcaagacggcccacttaga
gacaacacaggaaccgaaccggagcggtcctcatctgctgagacacagcagcctctgcatgatctcacagctgaaagcca
cagttcctcagcagactccagccgcagagaatcccctgccgaggaggagcccacgccggaggagcaagccatccatagag
tggccatccagctgaggaccataggggatgacatgaatgcagtttaccttcagagaaggaacgaggctcctcagtggcag
aactggagaggcctgtatcgtggtttggtggccttccttgctgacaccatcagcaccctctaccagcatggagtcagata
a
>gnl|bcl2dbcds|A0A672GN88_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Salarias fasciatus (length=420 residues).
atggatgatgaggaggaggacatgtcacggcccatctcgcagctctggggaacgtcctttagggaggtcaagtacgaaga
gcgagccgcacagatcgcagccggacaagccatcgacgcgctgccctgcagcttccaccggcagcctcgcgtacctttcc
acggtgaggacgggccgccatcacttcaaactactggcaggggggaagaaaatgacaggatggcagcagagaggcccgag
gagcaggcggggctgagcgttgaggcgcaaattggtcgtaaacttcgggagattggagacaagttccaccaggatcacgt
tgaactgcagcgcgtctgtgtctgggtagactgggccggctgtttatacgcccgtctaaaaatagagcctgactcacacg
cttatagacgcagccagtaa
>gnl|bcl2dbcds|A0A673WE74_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Salmo trutta (length=597 residues).
atggatgatgaagaggaggacatgtctcttcagcgtcctgtctcccagtgctggggcacccccttcagggacatcaagtt
ccacgacagggagagcagggacagagaagacacccaggacaggtctactcagacgtcgactggacccaacgccattgtcc
cacggtcagagggacaaaacatcatggtaccacaaggccacaacaacaacaactttccctgcggggtgcaggacaatcac
cagggcagaatactgttccatggcaacgctggattccgcttgcacttcccagctcggttcgagccaacggacgaccgggg
agagaggcagaacgaggagggaaggagggaggacgaggagaggaggagaatggaggaaagaccagaggaagagcgggtgg
aggatagcgcggaggcgaggatcggacgtaagctccgggagatcggagaccagttccaccaggaacatgttcaactgttc
ctgcggcatcagagggatgtcctaccagtctggattcgtctgaccatggccctctacggcttcctgtttaacagagaagc
ccctgctgtaccccacctgagaggacaggagagatga
>gnl|bcl2dbcds|A0A3B4XK57_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Seriola lalandi dorsalis (length=420 residues).
atggatgatgaggaggaggacatgtcacagcccatctcgaacctctggggaacgtcctttagggacgtcaaatacgaaga
ccgagccacaccgattgcagccggacaggcccttactgccgtcaccgctgctcctctcattctttttgtttggtgggttc
ctcattgggaactgtcccccagtaccaaaatgaatatgttaagattctcagagaataggcccgaggagcaggcaggggtg
agcgtcgaggcgcaaattggccgtaaacttcgggagattggagacaagttccaacaggatcatttcatgaggcaccagag
acaaaacctgcctgcctggatgcgccttacgatggccctgtttggctttctgtttccaagacaggctctcgtcccccgcc
tgagaggagagcagagatga
>gnl|bcl2dbcds|A0A671NFZ6_uncBAD-01 Putative BCL2-associated agonist of cell death gene OS=[Eukaryota] Sinocyclocheilus anshuiensis (length=219 residues).
tttactgatcagccaggatcagagactgaccagccttggaggccgcgtgttttctctgctcctccaaatgctgctgtgag
tgtgaaatacggcagacggctgaggagaatcacagatgagtttgacattctgctcgaaaaaggggtaagacgaactgaga
gcagggaattgctgttgtacttgtattcaacaaattcagtcacttgtggactgtcatga
>gnl|bcl2dbcds|A0A671NJM4_uncBAD-01 Putative BCL2-associated agonist of cell death gene OS=[Eukaryota] Sinocyclocheilus anshuiensis (length=405 residues).
gtgatggcgccaaagtcgacacattcggttgaggtgtcagaaacactcaaagaccgggacgattcagatcagtcagaggc
tggatcaccacagagaaagcagctcctcgctgtgcctgatcagtgggtgaggcagagggtccaatcgatggatgcagaac
tattttttaagaaagctgaccagccttggaggccgcgtgttttctctgctcctccaaatgctgctgtgagtgtgaaatac
ggcagacggctgaggagaatcacagatgagtttgacattctgctcgaaaaagggatgaagaggatgtgtaacggcagacc
ggcaccacagatacggcgcttccccatgagcttaagcttcctctggagccacgaagagtctgacgcagagaggaggtcac
actag
>gnl|bcl2dbcds|A0A671S371_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Sinocyclocheilus anshuiensis (length=723 residues).
atggatgatgaggaagacgaacagcttcctcactgctgtgaaacaccgctaagaaacaagagctcagagaacagagacgg
cccacgaggagaggtgggacaaacggctaacagacacggacgctttgaagacagatcgacgcagactgccagaactgtgc
tgaattcagcgagagatggagatatggcaccattccagggtttagagagagatgcatcatctccctgcggagctgtggat
cccaggactgcatttggggctaactgtggaactgggggcctcgtgtcacttactatggcccctggggccccagaagggcc
aagagcactttttcatggaaatgctgtatttcgttcacacttccccgcattgttcgaacccgtcccggatggcacacaaa
acgcagaagaggacggagggacaccagaagaaaaggaagacgaacgtgacgtgggaattagcgtggagattcagattgga
cgtaaactgcgcgaaatgggggatcagtttcagcaggaacatcttcagctggtaagagtgatttcagatgggactagttt
cttttcctcaagtctgtggttttcactgcagtggtttctgtcacgatgtgcaatgacatcatcgtctgttatttcaatgc
tgcatatgcaaatactcagtgggagagatgacatcatttttggtttacccttatattgtgtttttgttgtagttaaaaac
tag
>gnl|bcl2dbcds|A0A672JX19_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Sinocyclocheilus grahami (length=351 residues).
tactgtaaaaaaatcagtacaatttacggtaaaaaacagcagctgtggttgccagaactttactgtaacacaggattgtt
actgctagcgcctcccagccgctctcagcctccagacgtggttctccggcaggacctgcggatgatggacccagcggcgc
cacggcccgagcagagcgtggagaccctcatcgggcagaagctccagctgatcggagatcagttctatcaggagcacatg
atgcatcatggaaaccaaaggaaccaggagccgctgtggtggcgtgtgacggtggcgttctacacgctggtattcggcag
agaggcagacgcgagggaaaatcgcaggtga
>gnl|bcl2dbcds|A0A672L7Z7_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Sinocyclocheilus grahami (length=492 residues).
atggctgacagtataatcagagagcaaacgccgggccggggaagcggagagagcgccggtggcgcagccgtcttaggctc
cgggcactttgacttccctcagccgagcgatggggacccgttaaggggagggattgccatgtcgagtagtcaccagtcga
ggtcaccgatgtcccgaaccttctccaggtcctctagtggctatttttccgtcgacagcgattctgtgccaagttccccg
ctaatgcccaatatttccgaagcgcaagacggccaaaatgatgaggtatggtttgccgaacctagccaccagcacgcaca
gatggcggcacctgtgggagccatggggccggagatggcggtcgctcgggagctgcggcgcattggagacgagttcaacc
gcctgtactgtcagggggtgagtaatattcagggatttaggatccctctttggagtcccacttttttgggggattttatt
ttattttattag
>gnl|bcl2dbcds|A0A672SL07_uncBAD-01 Putative BCL2-associated agonist of cell death gene OS=[Eukaryota] Sinocyclocheilus grahami (length=348 residues).
atgtattccctcagcgaccagcacggatcagctccaggcatgacgaagcagatatcgtcctcttttggaagaccaaacaa
agtagtttcgctttcacaacgaagcacacagcgccttcacgacatgccttggaggccgcgtgttttctctgctcctccaa
acgctgctgcgagtgtgaaatacggcagacggctgaggagactcacagatgagtttgacattctgctcgaaaaagggatg
aagaggctgtgtaacggcaggccggcaccacagatttggcgcttccccatgagctcaagcttcctctggagccacgcaga
gtctgacgcagagaggaggtcacactag
>gnl|bcl2dbcds|A0A672T0P7_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Sinocyclocheilus grahami (length=708 residues).
atggatgatgaggaagacgaacagcttcctcactgctgtgaaacaccgctaagaaacaagagctcagagaacagagacgg
cccacgaggagaggtgggacaaacggctaacagacacggacgctttgaagacagatcgacgcagactgccagaactgtgc
tgaattcagcgagagacggagatatggcaccattccagggtttagagagagatgcatcatctccctgcggagctgtggat
cccaggactgcatttggggctaactgtggaactgggggcctcgcgtcacttactatggcccctggggccccagaagggcc
aagagcactttttcatggaaatgctggatttcgttcacacttccccgcattgttcgaacccgtcccggatggcacacaaa
acgcagaagaggacggagggacaccagaagaaaaggaagacgaacgtgacgtgggaattagcgtggagattcagattgga
cgtaagctgcgtgaaatgggggatcagtttcagcaggaacatcttcagctggtaagagtgatttcagatgagactagttt
cttttcctcaagtctgtggttttcactgcggtggtttctgtcacgatgtgcaatgacatcatcgtctgttatttcaatgc
tgcatatgcaaatgctcagtgagttatattgtgtttttgttgtagttaaaaacaaaaacagcagatga
>gnl|bcl2dbcds|A0A673GV92_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Sinocyclocheilus rhinocerous (length=612 residues).
atggatgatgaggaggacgaacagcttcctcactgctgtgaaacaccgctaagaaacaagagctcagagaacagagacgg
gagaggtggagaggtgggacaaacagctaacagacacggacgctttgaagacagatcaacgcagactgccagctctgtgc
tgaattcagtgagaaacggagatatggcaccattccagggtttagagggagatgaatcatctccctgcggagctgtggat
gccaggactgcatttggggttaactgtgtaaccgggggccttgcgtcacttactatggcccctggggcctcagaagggcc
aagagcactttttcatggaaatgctggatttcgtgcacacttccccgcactgtttgaaccagtcctggatggcacacaaa
acgcagaagaggacgaagggagaccagaagaaaaggaagacgaacgtgacgtgggaattagtgtggagattcagattgga
cgtaaactgcgtgaaatgggggatcagtttcagcaggatcatcttcagctgtttcttttcctcaagtggtttctgtcacg
atgtgcaatgacatcatcgtctgttatttcaatgctgcatatgcaaatatga
>gnl|bcl2dbcds|A0A673J7P6_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Sinocyclocheilus rhinocerous (length=270 residues).
atgtacaaaattgtactccgctctcagcctccagacgtggttctccggcagaacctgcggatgatggacccagcggcgcc
gcggcccgagcggagcgtggagaccctcatcgggcagaagctccagctgatcggagatcagttctatcaggagcacatga
tgcatcatggaaaccaaaggaaccaggagccgctgtggtggcgtgtggcggtggcgttctacacgctggtattcggcaga
gaggcagacgcaaggcagaatcgcaggtga
>gnl|bcl2dbcds|A0A673MJJ4_uncBAD-01 Putative BCL2-associated agonist of cell death gene OS=[Eukaryota] Sinocyclocheilus rhinocerous (length=354 residues).
tttttttataggtttaacagtgtgaaatcaaaatctttccaagcacctcctggacacttaaatgaagatcagtgggtgag
gcagagggtccaatcgatggatgcagaactattttttaggaaagctgaccagccttggaggccgcgtgttttctctgctc
ctccaaacgctgctgtgagtgtgaaatacggcagacggctgaggagaatcgcagatgagtttgacattctgctcgaaaaa
gggatgaagaggatgtgtaacggcagaccggcatcacagatacggcgcttccccatgagcttaagcttcctctggagcca
cgaagagtctgacgcagagaggaggtcacactag
>gnl|bcl2dbcds|A0A671V631_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Sparus aurata (length=459 residues).
atggatgatgaggaggaggacatgtcacggcccatctcgcagctctggggaacgccctttagggacgtcaaatacgaaga
ccgcgccacacagatcgcggccggtcaggccctcgctgctgtcaccgccgccgtgtccacgtcacagagtcacaacaaca
acagcattggcatcaacacactgccctgcagcttgcttcggcagcctcgcataccctttcacggcaacgctggattacgc
tcacatttccccgctcagtttgagcccatggaggaccggggagagaggcagattgaagaggaggaggaggaggacagagg
ggaggaagatgacaggatggcagaggggccggcggagcaggcgggggtgagcgtggaggcgcaaatcggtcgtaaacttc
gggagatcggagacaagttccaacaggaccatgttgaactggtaagcctcactccttag
>gnl|bcl2dbcds|A0A3B5B3B7_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Stegastes partitus (length=666 residues).
agtgatgagagtccaggctcacggtgcccgacagagggaagcggagcggatccagaacccgccggtgccgctggagcctc
ggcgcaaaagtcccgttcgaacgaggagcggagcgtcgggcagcgcagctccgccggaggagagccggactcaccgccgt
ggtgcccggccagcctaggcgtgtttcagaccaggtcgatatttcacctccctcgccgctcctccagtggatatttctcc
gccgacggtgccgactcggtgccgagctctccgctcttcctgaagcgactgacggctgacaaagccacgcagactcggag
ccccagcggccaggtgatcgaacacgccatggggcgcatggctgacgaggcgcacgaggcagtaggacgagcgctccgac
gaattggagatgactacgataggattctcatggtacgggtaagagacggccagtgtttgtgtgtctgtgtgtcggaggag
ggatgtgggcatcgacagcaaccgccagcagatacgttcgtacagatgttgaccaaagtcctgaaaactgcagtagagca
gctgttttgtcaaatcctgctttattttatctttttttttattatggtgggttatcttagctcatccaatgtgaagcccc
acgtggaaacaggcggcgtgaaatga
>gnl|bcl2dbcds|A0A674MBG0_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Takifugu rubripes (length=651 residues).
atggattcacgggctccgtccttgacgcgatttgccacaggtccgctgttccactgttgtagaaagtcatggaagcccaa
gctgacgaagacgctctgttcatccaacagaccaccgaaccgacccgatggatggccccccgtaattgcaacacgagcag
ccgaaggtgcccccggacaaacctcccgttcagtaaacggcggtgaacagagtcccacccgaacaggtgaaccgaaccag
atgccccgacgccgagtccccagctcccctttcgacagtctaggcgtgtttcagacaaggacaatcttcgctctccctcg
acgccgttccagtggatatttctcctccgacagcgactcgatgcccaactctccgctgtcgccgaggccgccgacgattg
atagtgcgacgcagacaccgagcccgagcggccaagtgatgctgcacgctctggagcgcatggctcaaaggttcggagga
gtcggagcacgggcgcagcagtggcacggtgagcacatgcagcctgcagtagtgtccatggaggcaggcagaggaatgtt
ggtagtcccgctgctgcacagcttactcctgccacacccagttctgctgattcagcctttattcgattttttttgtttgc
ttgtttcataa
>gnl|bcl2dbcds|A0A674IJJ5_uncHRK-01 Putative Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Terrapene carolina triunguis (length=264 residues).
atgtgcccctgcgcgctgcacggcgggccccccgccgcttgcctctgcagctccgcccggcgcggggagcgcttctccgg
ggcgcagcgggtggcggcccgcctgaagctggtcggggatgagctgcaggagcggaccgcgtggcggagggcgagcagcg
ggcgggctgcggccgggagaagcctggccacctacctgtgtctgctgtgcgccgccacgcaggtggccgcgctggtctgg
ctgatccgcaagaggagctggtag
>gnl|bcl2dbcds|A0A6I8R0S7_uncHRK-01 Putative Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Xenopus tropicalis (length=255 residues).
atgtgtccgctgcctttccgtgccagcctgccggaggtgtgtgtgtgcaactcggagcggccgggggagatctgttcccg
ggtacatgtaactgccgcccggctcaggatggtcggggacgagctgcaccggctgactgtcagcaggaagaacagcttcg
gtaggaagaggctttgtagctgcttctatctcctctatacggccactcacctggcggctctggcgctactcatgcagggc
aggaggaacctgtag
>gnl|bcl2dbcds|A0A6I8SZ38_uncHRK-01 Putative Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Xenopus tropicalis (length=348 residues).
atgagtaggagcgtcttatgtgaaaattcatatgcattatttttacttgggtgcccctgtacaccacataaggcgtgtgt
gtgcagcaatgggcggccgggagatatctgttcccgggtacatgtaactgccgcccggctcaggatggtcggggacgagc
tgcaccggctgactgtcagcaggaagaacagcttcggtaggaagaagctttgtagctgcttctatcttctctatatggcc
actcacctggcggctctgtggcagccatgtctccctgtcattcattgtgggagtctccataaacaccggctgacacccag
gcactgccttgttgtagccctgtattag
© 1998-2021Legal notice