Dataset for CDS Unclassified of organism Terrapene carolina triunguis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A674IJJ5_uncHRK-01 Putative Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Terrapene carolina triunguis (length=264 residues).
atgtgcccctgcgcgctgcacggcgggccccccgccgcttgcctctgcagctccgcccggcgcggggagcgcttctccgg
ggcgcagcgggtggcggcccgcctgaagctggtcggggatgagctgcaggagcggaccgcgtggcggagggcgagcagcg
ggcgggctgcggccgggagaagcctggccacctacctgtgtctgctgtgcgccgccacgcaggtggccgcgctggtctgg
ctgatccgcaagaggagctggtag
© 1998-2020Legal notice