Dataset for CDS Unclassified of organism Takifugu rubripes

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A674MBG0_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Takifugu rubripes (length=651 residues).
atggattcacgggctccgtccttgacgcgatttgccacaggtccgctgttccactgttgtagaaagtcatggaagcccaa
gctgacgaagacgctctgttcatccaacagaccaccgaaccgacccgatggatggccccccgtaattgcaacacgagcag
ccgaaggtgcccccggacaaacctcccgttcagtaaacggcggtgaacagagtcccacccgaacaggtgaaccgaaccag
atgccccgacgccgagtccccagctcccctttcgacagtctaggcgtgtttcagacaaggacaatcttcgctctccctcg
acgccgttccagtggatatttctcctccgacagcgactcgatgcccaactctccgctgtcgccgaggccgccgacgattg
atagtgcgacgcagacaccgagcccgagcggccaagtgatgctgcacgctctggagcgcatggctcaaaggttcggagga
gtcggagcacgggcgcagcagtggcacggtgagcacatgcagcctgcagtagtgtccatggaggcaggcagaggaatgtt
ggtagtcccgctgctgcacagcttactcctgccacacccagttctgctgattcagcctttattcgattttttttgtttgc
ttgtttcataa
© 1998-2020Legal notice