Dataset for CDS BCL2L11 of organism Taeniopygia guttata

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A674H354_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Taeniopygia guttata GN=BCL2L11 (length=570 residues).
atggccaagcagccccccgaggtgaaggcgcgacgcgacggcgagggcgggcggctgccggcggcggaggggccgggccc
gggcgcgcagctgcgtcccggcgctcccgccgccctgcctggggccggcccggtgtccgcgggcgccgcggcgcggggcc
cgcccgccagccccggccccttcgccacccgctcgccgctcttcatcttcgtgcggaggtcgccgctgctgccgcgctcc
tccagcgggtacttctccttcgacgccgagcgcagccccgcacccctgggctgcgacaaggccacgcagacccccagccc
gccctgccaggcgctcagccactgcctcagcgccatggcttcccgatggcaatcccactctccggctgaagaggtgcagc
cggaaatctggattgcgcaagagctgcggcgcattggggacgagttcaatgcctcctattgtccacgcaggggcttcttg
gatcaacaggtgggaaatccccaggtcatgatcttgcgcctgcttcgcctgctgcattccatcattcgcctcatctggag
gctccactga
© 1998-2020Legal notice