Dataset for CDS BAD of organism Sphaeramia orbicularis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A672YF93_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sphaeramia orbicularis GN=BAD (length=504 residues).
atggctgcaaaattcaccatttccgacagtgaatcagagccatccgaagatttagaggaggaacaacgccgtcagccacc
gactgaacaggagcagcagatttcttacagccactccctcactctacctgagctcagaatggcaggggccgggcgactca
ggctgaactctgagtcccaagtttccaatgtcaccagagacgaggagctccagatgaggggggaagatgaagccagcact
cccacggaaggagccccattcagggcacggtccaagtcggctccccccgccttgtgggcagccaagaaatacggccagca
gctccggaggatgagcgatgaatttgacagcctgctagacaagggggaaatgaagagggtgagaagtgcggggacagcca
gacagatgcaccactctaaaacttggtggagctacctctttagtcaccaggagatggaaggagagaacagccaccatgaa
aaccacaaaaaccgcactgagtaa
© 1998-2020Legal notice