Dataset for CDS BAD of organism Sparus aurata

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A671TL42_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sparus aurata GN=BAD (length=501 residues).
atggctgcaaacttcaccatttccagcgagagcgactcagagccctcggaggaggtcgaggaaggagaacacagccaatc
accagctgaagaagggcagcaggtgtctcagcgccacgccctcaccctacctgagctcaggatggcaggtcgaatcaggc
tgaactcagagtcccacgcttccaccgtctccagagacgtggagctccaggcgaggggtgaagacgaggctggaacgccc
accgacggagcgccgttcagggggcggtccaagtcggctccccctgccttgtgggcggccaagaaatacggccggcagct
ccgaaggatgagcgacgagttcgacagcctgctagacaaaggggagatgaggaaggtgaagagtgccgggacgcccaaac
agatgcaccactcgaggagctggtggagctacctcttcagccaccaggagatggagggagagaacaaccaccatgacaac
cacacacaccgcactgagtag
© 1998-2020Legal notice