Dataset for CDS Unclassified of organism Sinocyclocheilus grahami

[Download (right click)]

4 sequence(s)

>gnl|bcl2dbcds|A0A672JX19_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Sinocyclocheilus grahami (length=351 residues).
tactgtaaaaaaatcagtacaatttacggtaaaaaacagcagctgtggttgccagaactttactgtaacacaggattgtt
actgctagcgcctcccagccgctctcagcctccagacgtggttctccggcaggacctgcggatgatggacccagcggcgc
cacggcccgagcagagcgtggagaccctcatcgggcagaagctccagctgatcggagatcagttctatcaggagcacatg
atgcatcatggaaaccaaaggaaccaggagccgctgtggtggcgtgtgacggtggcgttctacacgctggtattcggcag
agaggcagacgcgagggaaaatcgcaggtga
>gnl|bcl2dbcds|A0A672L7Z7_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Sinocyclocheilus grahami (length=492 residues).
atggctgacagtataatcagagagcaaacgccgggccggggaagcggagagagcgccggtggcgcagccgtcttaggctc
cgggcactttgacttccctcagccgagcgatggggacccgttaaggggagggattgccatgtcgagtagtcaccagtcga
ggtcaccgatgtcccgaaccttctccaggtcctctagtggctatttttccgtcgacagcgattctgtgccaagttccccg
ctaatgcccaatatttccgaagcgcaagacggccaaaatgatgaggtatggtttgccgaacctagccaccagcacgcaca
gatggcggcacctgtgggagccatggggccggagatggcggtcgctcgggagctgcggcgcattggagacgagttcaacc
gcctgtactgtcagggggtgagtaatattcagggatttaggatccctctttggagtcccacttttttgggggattttatt
ttattttattag
>gnl|bcl2dbcds|A0A672SL07_uncBAD-01 Putative BCL2-associated agonist of cell death gene OS=[Eukaryota] Sinocyclocheilus grahami (length=348 residues).
atgtattccctcagcgaccagcacggatcagctccaggcatgacgaagcagatatcgtcctcttttggaagaccaaacaa
agtagtttcgctttcacaacgaagcacacagcgccttcacgacatgccttggaggccgcgtgttttctctgctcctccaa
acgctgctgcgagtgtgaaatacggcagacggctgaggagactcacagatgagtttgacattctgctcgaaaaagggatg
aagaggctgtgtaacggcaggccggcaccacagatttggcgcttccccatgagctcaagcttcctctggagccacgcaga
gtctgacgcagagaggaggtcacactag
>gnl|bcl2dbcds|A0A672T0P7_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Sinocyclocheilus grahami (length=708 residues).
atggatgatgaggaagacgaacagcttcctcactgctgtgaaacaccgctaagaaacaagagctcagagaacagagacgg
cccacgaggagaggtgggacaaacggctaacagacacggacgctttgaagacagatcgacgcagactgccagaactgtgc
tgaattcagcgagagacggagatatggcaccattccagggtttagagagagatgcatcatctccctgcggagctgtggat
cccaggactgcatttggggctaactgtggaactgggggcctcgcgtcacttactatggcccctggggccccagaagggcc
aagagcactttttcatggaaatgctggatttcgttcacacttccccgcattgttcgaacccgtcccggatggcacacaaa
acgcagaagaggacggagggacaccagaagaaaaggaagacgaacgtgacgtgggaattagcgtggagattcagattgga
cgtaagctgcgtgaaatgggggatcagtttcagcaggaacatcttcagctggtaagagtgatttcagatgagactagttt
cttttcctcaagtctgtggttttcactgcggtggtttctgtcacgatgtgcaatgacatcatcgtctgttatttcaatgc
tgcatatgcaaatgctcagtgagttatattgtgtttttgttgtagttaaaaacaaaaacagcagatga
© 1998-2020Legal notice