Dataset for CDS BAD of organism Pseudonaja textilis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A670YRG7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pseudonaja textilis GN=BAD (length=312 residues).
ttagaactgagacgccgcattgggtcggaccaactcgattcggagacctccgatgaggtgggggctttccgggcccgctc
acgctctgcccctcccattttgtgggccgcgcaacgatacggccgagaattacgcaggatgagcgatgaatttcacggcc
tgccgcgcccgaaaagcgccgggacctgctcccacatggaccgccctcctcccagctggaaagacaccctgcggtcgtgg
tggctttactccggatctgacattatggcactgtccagattttcaccctctgctccttcaaccctaaattaa
© 1998-2020Legal notice