Dataset for CDS PMAIP1 of organism Podarcis muralis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A670IXL8_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Podarcis muralis GN=PMAIP1 (length=171 residues).
atgccctcccagcgccttgaactacaactcccaccagccccagcatccacaaccaatgactcggaggcggtacgggaatg
tgcattgcagctacgcaggatgggggacaaatggaacctgcgccagaagatcctcaacctgatttcaaagcttttctgcc
ccgaaacgtga
© 1998-2020Legal notice