Dataset for CDS BAD of organism Podarcis muralis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A670JUY4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Podarcis muralis GN=BAD (length=276 residues).
ctggagtttaataacatcagaaaggactggaccttggccttgggcactttccgggcacgctcacgctctgcccctcccat
cctgtgggcagcccagcggtatgggagggagctgcgcaggatgagcgacgaattccatggcgagctgcagaagctgccgc
gccccaagagtgcagggacagctacccaaatgcgccggacgttgggctggaaggaggttctgcagtcatggtggcgtcgg
aattccccaggcaatggtccaagaagccccccatga
© 1998-2020Legal notice