Dataset for CDS BBC3 of organism Piliocolobus tephrosceles

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C9GX27_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BBC3 (length=810 residues).
atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgccgcccccgctgcccccgccctgc
tgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccacgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcc
cgtgcccagcgccccgggggccctggcgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcgggtgagtgctgggggt
ggggtagacggcaggtgggacttcccgccggaggagggggcggcaggcggcccccgccagatgtgctgcagctgctgccc
cgcgcggctgggtcgctccgcggacaggcaggtggggggtgagtgggtgggggggatcgcgcgcccgcagagccgcccag
ggactccgcgccgcggctggcatagtcggagcccgagccagggccagggccagggccgggaactaggctgccgcggagac
cagcggcgcgcccgtagcccgcggccgcggggactgagggcgtcgctgggcggcgcggctcatatatcccgggctattta
tagctggtga
© 1998-2022Legal notice