Dataset for CDS PMAIP1 of organism Physeter macrocephalus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2Y9TJ73_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Physeter macrocephalus GN=PMAIP1 (length=165 residues).
atgcctggaaggagggctcgtaagagcgctcagcagagcccgacgcgggccccggcagatcctgaagttgagtgtgccat
tcagttcaggagaattggagacaaactgaatttccggcagaaacttctgaatttgatatccaaactcttccgctcaggaa
cctga
© 1998-2020Legal notice