Dataset for CDS PMAIP1 of organism Peromyscus maniculatus bairdii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A6J0DIY6_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=PMAIP1 (length=315 residues).
atgccccggagccaggcgcgtccgaacgcgccatcgaacgcagcgtgggcagagctagcgcccgagttcgcagctcagct
caggaggatcggagacaaactgtattctgcgcggtgtgaacccgacatcactgcggtgctggcggagatgcctggcagga
aggcgcgaaagagcgcgaccaggagctcaagcccaacgccggattcagaagacctggaagatgagtgtgttcaactccgg
agaattggagacaaactgaatttatggcagaaacttctgaattttatttccaagctctttaatttagtaacctga
© 1998-2022Legal notice