Dataset for CDS BCL2L11 of organism Pelusios castaneus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C8SQS1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Pelusios castaneus GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatctaaattcagagtgcgacagagaagggggacaatttcaatcagttgaaaggccaagtca
gcctcagcatcttagacctggggcccctacctctatacaaacacagtatcaagattccaggtgccagtctgcctcaatac
atgaagacatgcagccagaaatatggattgcacaggaattgcggcgtattggagatgagtttaatgcctcctattgccca
agaagggcatcaattgctttcttcgtcttccctgctttggagctgcagagaggaaatgccctggattgggacagtcccat
cacgtcaagcgagttctaa
© 1998-2022Legal notice