Dataset for CDS BAD of organism Panthera tigris altaica

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C9J6L6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Panthera tigris altaica GN=BAD (length=510 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctacggataggggcctgggccccagccccac
aggggaccggccccgcggccctggcaagcaccagcggacggccccaggcctcctcggggaagctggtcaccagcaggggc
agcccgccagcagcaaccaccatggaggcgctggggctgtggagacccggagtcgccacagctcgtaccccgccgggacc
gaggaggatgaagggacggaggaggaagagcccagccctttccggggtcgctcgcgctcagcgccccccaacctctgggc
cgccctgcgctacggccgcgagctccggaggatgagcgacgagttccagggctccttcaagaagggacttccacgcccga
agagcgcgggcacagcgacgcagatgcggcaaagccccagctggacgcgcttcatccagtcctggtgggatcggaacttg
gggagaggaggctccgccccctcccagtga
© 1998-2022Legal notice