Dataset for CDS BIK of organism Panthera leo

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C9D8E2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Panthera leo GN=BIK (length=447 residues).
atgtctcacgcaggatccctctccaggaacgtctttttgagcaccttcctgcaggagcatggcccggaagttctggacgt
tcctggcatgaccgatctcgtggagtactatgatcctgggccctcccctaacagcaacagccccgacgatgtggccatgc
ggctggccttcatcggggatgagatggaggtgaggtggatgatgccccgcgttggcgagctgcccgggatggccatgtac
agcttggccttcacctacaaccagacgggcctgagaggtgttctcagaagtctcgtggatggtctggccaacctcaggga
gaacatacggatctggggcttcctgaccctcaggaacagggtgtcccccaactccgggcgcgggctggcgctgtccctgc
tgctgctggtgttgctgctgggctgggggctccacctcctccagtga
© 1998-2022Legal notice