Dataset for CDS BBC3 of organism Oryctolagus cuniculus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A5F9DGT6_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BBC3 (length=549 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagagggcctggcccgcgacggccctcgcccccttcccgc
ttggtcgcctggtgccctcggccgtgtcctgcggccttctgcgagcgggaagtccctcctggaatctgactgcagtcccc
gagctgcggccggcgggctcctcccggcctccagccacagcggtttcccagcgcccctcccccggcctgggcccccgcga
cccccacggggctcgcagttggaaggagggccagtcactggagtcgtcccgtgcccagcgccccgggggcccctggaggg
ggtccccaccccggcggccccgggagtctggggcgaggaggagcagtgggcccgagagatcgtggcccagctgcggtgga
tggcgtacgatctgtacgcgcagtatgagcgcagacaagaggagcagcagcgacaccgcccttcgccctggagggtcctg
tacaatcttctcatgggacttctgcccttacccaggggccccggagccccggagatggagcccaactag
© 1998-2020Legal notice