Dataset for CDS Unclassified of organism Ornithorhynchus anatinus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A6I8PDD6_uncHRK-01 Putative Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Ornithorhynchus anatinus (length=345 residues).
atgtgcacggtgccccggggcggcgggggttgcggcgggggttgcggcggggagggcggggtgggcgggggttgcgggtg
ggggtcggggtctgcggcgcgggtgacggtggcgcgtctgaaggcgctgggggacgagctgcacgagaggacggcggcgc
ggaggaggcggctgggccgcgggggacggggccggggggtcctgccctccctgccttcgtccctgccctccctgccctcc
ctgccttcatccctgccatcctcgcccccgggctgggcttggctgtgcgcggcggcgcaggtggcggtcctggcggcctg
gctgctccggaggagaaacctctaa
© 1998-2020Legal notice