Dataset for CDS classical BH3-containing proteins of organism Nothoprocta perdicaria

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C6Z034_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Nothoprocta perdicaria GN=BMF (length=573 residues).
atggatcgccccagctacatggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggctttttcacacagaaccaaacctgccttcggaggtttcaac
tattccccctcacacactgctgtggtcccggtagcaggcatcccgagcagcaggacaaggcaactcaaacactcagcccg
tcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaatgctggcta
ccgtttacacgttcctccagttggctttgcattggatccccgtctccaagagcagcctcaggaagcccagcgggaagccc
gtgccgaggtgcagattgcacggaagctgcagtgcattgcagaccagttccaccggctccacatacagcggcatcagcag
aacaggaatcaagtgtggtggcagctccttctcttcctacacaacttggccttaaacgtggaggcgaacaggaaccgcac
cgggcagaggtga
© 1998-2022Legal notice