Dataset for CDS PMAIP1 of organism Neovison vison

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C7BEU9_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Neovison vison GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgtaagagcgcgcagccgagcccagcgcgggccccagcagaccccgaaatggagtgtgccat
tcaactcaggaaatttggagacaaactgaatttccggcagaaacttctgaatctgatatccaaactctttcggtcgggaa
cctga
© 1998-2022Legal notice