Dataset for CDS Unclassified of organism Neogobius melanostomus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C6ULE5_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Neogobius melanostomus (length=498 residues).
aagccaccgtcaagttcgcaagagacgcagggcacaatccctgatgtggcaggtgagtggaggaaggctcgcagaccggc
cgacaaacccgagtggcgccccagacgcgtgtgggagcagaggcgcgcagtactcctctgcagccgacagccgcggcggg
ctccatatcaggccactcgctccacgcgccgctcctccagcggatacttctcctacgatagtgagtctcaacccggatca
ccactgtccccgcgaccacttacggctgacacggccacgcagactgccagtccaagcgcgcaggtgattgagcacgcagt
gaacagcctcgcagcagcagcgcgcggacacggggaaagcgcacaccaacagcagcatggtgagcgtgagcgatgcgtga
aagggcgacgattgtctaaaatagcaatatgcctaatacttaagctgaagttacaatatgcctacttgccattctgtgtt
tctcgaggcaaactttaa
© 1998-2022Legal notice