Dataset for CDS PMAIP1 of organism Nannospalax galili

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C6RUL4_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Nannospalax galili GN=PMAIP1 (length=315 residues).
atgcccgggagcgaggcgcgtcagagcgcgccatcgaacgccacgcgggcagagctagagttggagtgtgccgctcagct
taggagaattggagataaactgaattccactgggcgtgctgctgacatcacagcagtgctagcagagatgcccggaaaga
aggctcggaagagcgcgcagcggagcccgagccctgcgcggttgccggcagatctggaagctgagtgcgctcaactgaga
agaattggagacaaactgaactttcggcagaaacttctgaatttgttctccaaactctttaatttaataacctga
© 1998-2022Legal notice