Dataset for CDS BCL2L11 of organism Myripristis murdjan

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A667ZMY7_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Myripristis murdjan GN=BCL2L11 (length=411 residues).
ttatcagatgtgaccgcggcgcaaaccccccgcgcagcgccggcgaacgaaagcggcggacggtgccgcggccacgccgc
tcctcccggagggaagggggactcgccgtcccggggagccggcccgcccatctcaccgactaacagcctgtccggatatc
agttgaggtcgccgctgttccggcacctgtctcgctcctctagcggatatttctcgtacgacggcgactcgttgcccggc
tccccgaggccagcaacggtggacaaggccacacagactccgagcccctccggccaggcggtgacacacgccgtgctgcg
cctgaccgaggagcacccgcacggtgagcacaggaactcacacacagccagccacgtagacgggccactgccactccgca
tgattcagtag
© 1998-2020Legal notice