Dataset for CDS BAD of organism Myripristis murdjan

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A667ZNC6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Myripristis murdjan GN=BAD (length=492 residues).
atggcaagcttcaccatttcagacggcgaatcagatccctcagaggaggtaggggagtcagaaaccgacaaatcactcaa
tcatcaggagcagaaccatcatcttggccacgccctcaccacacctgagctgagaatgtcagcaagtggccgggtcaggc
tgaactctgaatcccacgtctccactgtctccaaagacgaggagctcctggccaggggggaaggagaggatggtgacgga
gctcctttccggggtcgctcccagtcggcgccccctgccctctgggcggccaagaaatatggccgtcagctccgaagaat
gagtgacgagtttgacagcttgctggacaaaggggagatgaagagggttaggagtgctgggacggccaaacagatgcagc
actccaaaagctggtggaactacctcttcagtcaccaggagacagaaggagagaccagccaccatgaaaaccacagtaac
cgcactgagtag
© 1998-2020Legal notice