Dataset for CDS BAD of organism Marmota marmota marmota

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C5Z4I8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Marmota marmota marmota GN=BAD (length=513 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagctccgcagaagggggcctgggccccagccccgc
aggggaccggccaggcccctacaagaatcaaccaccaggctgcggcttggctccaggcctccccagggacaccggtcacc
agcagcggcaggcaaccagcagcagcaaccatggaggcgctggggctacggagacccggagtcgccacagctcgtacccc
gcagataccgatttggatgaagagatggaagaggagcccagccccttccgcggccgctcgcgctcggcgccccccaatct
ctgggctgcacagcgctacggccgcgagctccggaggatgagcgacgaattcgagggctcctttaagggacttcctcgcc
cgaggagcgcgggcacagcgtcgcagatgcggcaaagctccagctggacgcgcttcatccagtcctggtgggatcggaac
ttggggaggcgaggctccgccccctcccagtga
© 1998-2022Legal notice