Dataset for CDS PMAIP1 of organism Macaca mulatta

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A5F8ATY0_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Macaca mulatta GN=PMAIP1 (length=162 residues).
atgcccagcaaaaatgagaaaaccaacctccagcctcagcccaccaatcaacagatggaattgcaaattcagtttgcaaa
gaggaaaagagcgtttgggggaagattaaatagaagagacaagagtcttgctctgtcacccaggctggagtgcagtggcc
cg
© 1998-2020Legal notice