Dataset for CDS Unclassified of organism Leptobrachium leishanense

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C5LNA1_uncHRK-01 Putative Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Leptobrachium leishanense (length=255 residues).
atgtgcccgctgcccttccatgccagcctgccagaggtgtgtgtgtgcacctctgagcggccaggggggctttgctctgg
ggtccaggtgacagcagcccggctcagaatggtcggggaccagctccaggagctcacggtccgcaagaagtccagcatgg
gcagaaagagactgtgtacctgcttctacttgctctacacggccacccacctggcagccctggcactgctcgtgcagggc
aggaggaacctgtag
© 1998-2022Legal notice