Dataset for CDS BAD of organism Lates calcarifer

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A4W6EMZ7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Lates calcarifer GN=BAD (length=504 residues).
atggctgcaaacttcactatttcagacagtgagtcagaggcttcggaggaggtagaggagggagaaatgaaccaatcatc
aactgagcaagagcagcagattcctcaacgcaacaccgtcaccctccctgagctcagactgccagtgcccggtcgaatca
ggctgaactcagagtcccacgcttccactgcctccagagacgaggggctccaggtaaggggggaagaggaagccgggacg
cccaccgagggagctccattccggggacggtccaagtcagctccccctgcgttgtgggcagctaagaaatacggacagaa
gctccgaaggatgagcgatgagtttgacagcctgctagacaaaggggagatgaggagggtgaagagcgctacaacgacca
gacagatgcaccactctaaaagctggtggagctacctctttagtcaccaggagacagaaggtgaaaacaaccaccacgaa
aaccacactcaccgcactgagtag
>gnl|bcl2dbcds|A0A4W6EMZ7_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Lates calcarifer GN=BAD (length=690 residues).
atgtacaggaacaaatgttgtttggtcatcatttgtatgaataacgtgcttaacgtttgttttcctactgtggtattaat
aactgtgaaactcagtaacattgactcgtgcacatctacttatgggcatttccttgtctataatagagtacaatttcttt
tgaatcttccctccccagatgtcacaatggctgcaaacttcactatttcagacagtgagtcagaggcttcggaggaggta
gaggagggagaaatgaaccaatcatcaactgagcaagagcagcagattcctcaacgcaacaccgtcaccctccctgagct
cagactgccagtgcccggtcgaatcaggctgaactcagagtcccacgcttccactgcctccagagacgaggggctccagg
taaggggggaagaggaagccgggacgcccaccgagggagctccattccggggacggtccaagtcagctccccctgcgttg
tgggcagctaagaaatacggacagaagctccgaaggatgagcgatgagtttgacagcctgctagacaaaggggagatgag
gagggtgaagagcgctacaacgaccagacagatgcaccactctaaaagctggtggagctacctctttagtcaccaggaga
cagaaggtgaaaacaaccaccacgaaaaccacactcaccgcactgagtag
© 1998-2020Legal notice